Description :
From Genome Similarity Track
Location :
Scaffold_140:48415- 49733
Sequence
1318 bases(100 bases per row)
AACATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGTTCGGACGACGTGTCGGACCCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTT
GGCTGATCCTCGGCGACGACACTGAATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGTAAAGAGGTCCGGCGTCGCGGATACTATGAG
ATCCAAGTCTAGCTTGAAGATGTCCTCTGCGTCGAACACACCGGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGTCACCAACTTG
TTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGTATGACAGGATCTTGATGCAGGAAGTCGCGTA
AAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATTCAGCTTGGTCTTCTTCCGACTCTAGAGCTTGCATCTTCTTCCG
CGTAGTCTTACTCGTTTTCGTCTTCGTTCTCGTTTCTTCGATTAGCGGGGTTGGGTTTAGGTACGGTGCTGGCTTAACCGATCAATCTGCAAATTCATAC
CGTTTCGCCTTCACTTTCCCTTGTTTTGTTTGCGGATCTTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGAGGAGGATAGAGAGGTTTC
TCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGTGGCTTCGTCGATC
CGACCTCCGACGACGCCTCTTCCCCTGGTTCAATCTTCACTTGAGCATCTTCTTGGGACTTACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCG
CACCATTGTGGTGTAGCGAGATAAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAACCGCGCCCAGACACCGACAAACGGAGGGGGGCCCCCGATG
ATCCGTGATCTGCTGAACGTTCCTCACCTTGTGGCCCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGCTCAAGTGGTGAAGCTTGG
GCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGTAGTGATAAGATCTTCACTCTGCGTCCGTGATTGGTTCTGGATCTTAAGCGAATGTTCGAGTTGG
TGGATCCAGGGCCTAGATCGTGTAACGAGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTCGTCTTTGCGTTTCCTTGGCGTCGTACTTCCCGCCTCCTGTG
ACGGGATCTTGAGAGTTG