Description :
From Genome Similarity Track
Location :
scaffold_169:48412- 49418
Transcript NameFunction/comments
Pl_108377conserved hypothetical protein

Sequence
1006 bases(100 bases per row)
CACACATGCCTTACAGAAGTGTGTCTTGACCACTTGGAAAATGCGTGACTTGTTGTCCGCATTGTAATCACGCGGCACATTGCGAACAATCACGCAATGA
TGGCAAAAGATGTCTCCACAAAGCCGGCAGTGGTAACGACGGCGAGTCGCAGCATTGAACGGGAGTTGACAGCTCGCACATGCCTTGCGCGAGTCATTGG
GCACCCAGTTCGCTTTGCACATCATTCCCTGTTTCAGAATCTGCTTCGAGTCGACAAAGAGGGACATGTCGTTGTAAATGCGCATGAACTTCTTGAAATT
CTTGGCACGCACCGACAACCCGGCAAAGTCGTTTTCGCTCATGATGAAGAGCTGTGTCGCATCCGTAGAGGACCCTGCCGGGCGGACGATGGAGACGCTG
TGCGTCTTGACGCGCTTGATTCTCAACGACCGGTACAAATCCGGACACTCTTCGATCTCCACCGGTAAGGTTACGCGGACACCCACGTCACGACCGAGCT
CGTCCTTGGTGTACGTCAGGTACTCCAGAAAGCAGTTGTCGCGCTTACGGCCGAATGAAGAAGGTTGAAGGCATGTCCACTTGATACCCATGTACTCGTG
CTTCCTTGCTGAATTTCGAGTGTGAATGTTCTTGAGAACGACCGCGTCAACCGCGTAGCCGTACATGAACTGGTTCCACTCGAAAAGCTCCTGCGATGTC
TCTGCGTAGTAGAAGTCCATGAAATTTCGATAGTTGCCGTGAATGCGTCCATAGAGACGGAACTCGCTGTGTGAAAGTCCTTCGGGTGTCTCCTTTCGAA
TGGCAGTCAATGGACCTTCGTTGCCTACCAGTACCCAAGGAGCATTGTAGATCGGATAAGCCCCTTTAGCTTCATGGCGCTCATATTCCATCAAAGCGTT
TCGGACGATTTTCTCGACCTGCATCTCGTAGCTCCGGATTTGTTCGTCCGTAAGCTTAACCTCTGGAAAGAAGTCATTGGGTAGTGGAAATGTCTTGGAG
TCGTTC