Description :
From Genome Similarity Track
Location :
Scaffold_1073:4841- 6191
Sequence
1350 bases(100 bases per row)
CCGGACTTCCAGCCTTCGCCGATCACGGATCAAGCGTGTGCACCGATAGATGACGCGAAGCCGCAAGATGATCGTGCTGGCGATCCAGAGGGGAAGCCAG
AACATGTGGATTCCGGTGGTAAAGCAGCTGAGAAGGGCGAAATCGTGCCCCCTCATTTGCCATCGGCCGATCAGGTCGACGGTTGTGCCGTCGAACCAGA
TCTTGGGGGCGGGAGTACCGATCGGACACACCCTGTTGCGGTCTTAGCTGTGGAAGAGTCGAGATCAAGTGATGATACAGCAGTCGACGGTGTTCCTGCA
TCTGAACGACTGCCGCAAGTGGCTGAAGACTCATCGATCGTTGGAGGTGATCAGCTGGAAATGGAGGCCAAACCCACTTCAAATCGGGACGACCTCATTG
CATCCGAACCAGATCGAGATGTTGGCGCTGATGATCAGGTCCATTACCACGAGGGCCGGAATCTGTCAGCAGAAGATGTCGAAGGTGAATTAGCTGTGCT
TCCTGAAATTGTGATCTCGACGACGGATGAGGTAAAGATCGATGATATCAAGGTGGGAGATCTGGAGTTCAACACCCTGGAGGAGATCGATCGGCTGCGA
AAGAAGATCTGGCACAGGAATCACCTGCTGATCGGCAAGGGCAATGCACTTCCCCCAGCAGCCCAGGGCGTCACCTGCGACATCGACGTGGGCGACGCGA
AGCCGATCACTCAACGTGTCCGGAAAGTTGCCCCTCAGTTCGTGGAGAAGGTGTCCGAGCTGATCAAGGGATTATTGTCAGCCAAGATGATTCGGAAATC
TCGATCACCATGGGCCTCGCCGATCGTCGTGATCACCAAGAAGAACGGCGTGGATATCCGACTCTGCATAGATTATCGGCTCGTCAACAGTCTAACCAGG
CTGATGGTATATCCGATGCCCTTGATCAACGATTTGCTGGAGGATCTGGATAAGGTACTCTGGTATTGCTCTTTGGACATGGCTAGTGGATTCTGGGTGG
TGACAATGACCGATCGAGCTCGTGCGATCTCGGCCTTTATCACCCACATGGGTCTGTTCGAGTGGAACCGGATGCCGTTCGGCTTGAAGAACGCTCCTCA
GATCTACCAGCGACTTCTGGACGACGCGTTTTATGGGTTCACCAGGATCCCGCGATCGTCAGACTGTGAAGTCACTACGGACTTGATCGAGTCAGGAGAA
CCAGAAGATCCGGGGCGTCCATCAGTGCTAGGTCGCAGATTGTACATCGATGACATTCTTGTGACGGCCGGATCATGGGATGAGCTGTGCGATCGTGTGG
GTCACCTGCTGGACGCTTGTGATAAGTGGAACATCTCGATCAGTGTGGAG