Description :
From Genome Similarity Track
Location :
Scaffold_41:484018- 491877
Transcript NameFunction/comments
Physo_108905L-aspartate oxidase
Physo_135928asparagine-linked glycosylation 9 protein isoform a
Physo_135929hypothetical protein
Physo_135930hypothetical protein
Physo_135931cell 5A endo-1,4-betaglucanase

Sequence
7859 bases(100 bases per row)
AGGACGCGGACTGGATCAAGAACCGCTTCCCGACTATCTACAAGCACTGCCTCGACCGTGGCATCGACATGACCAAGGAGCCGATGCCTGTGGTTCCCGC
CGCTCACTATCACTGTGGTGGTGTCGAGGTTGACCTCCAGGGTCGCACTACCGTTCCTGGTCTGTACGCCGCGGGCGAGGTGAGCTGCACCGGTCTCCAC
GGAGCCAACCGCTTAGCCTCGACCTCGCTACTTGAGGGACTCGTGTGGGGCTGCAGCTCGGCTGACGACTTTATGGAGCGCAGTGAGAAGCTCAACTCGG
AGAGCTCAAAGAAGGAGGACGATCCGTTCGCCAACCTGAACGGCTTCCGCGACCCGTACCCGAACGAGATTGAGGAGGTGATGCTGGCGACCCAGCGCAT
CATGTGGGAGTCCGTTGGCCCGATCCGCACGGCTGCCGGCATGGACAGCGCCGTAGACAAGCTCGCGCTGCTGGAAGTCAAGGCCGACAAGCTGCACCAG
GAGTGCCGTGTCACGCGCGAGACCGCTGGTCTGCGTAACGCTGTGCGCGCGGCCAAGGAGATCGCTTTGGCTGCTCTCAACAGCCCGCTCTCTGTGGGCA
CGCACTACGTCGTAAAGGAGTAAGCGACCACCACGATCCCCGTCGCTGTTTACCTTTTAGTCTGCACTGTTGCTCAAGCTACAGATGTGGACCTGCACTT
GATAGTCGACATCTCAGCTTCGACATGAACTTTAAGCTTTTCAATTCCAATTCAACTTTGCCAGCACTTCAACCTCAGTTTGTGTGTTGTACACCACATA
ATGTTTGCACACATTTCCTTGCAACATCCGAAGGTATCCCGTCCAAGTCAATGCCGACTCGACGCGTCACCAAGTCAGAGGCGAAGGCGTCGGCCGCCGC
CGCCGCGCAGGTGCGCAACGAGCAGCTGGATGAGCGTCAGCTGTGGCTGCCCTCGCTGGAGACGGCGCTGTCGCTGCTGGTCCTGCCTCGCGCCGTGTCG
GCGTTGCTGAGCCCCATCGCGGACTGTGACGAGACGTTCAACTACTGGGAGCCGCTGCACTACCTGCTCTACCGCTTCGGCTTCCAGACGTGGGAGTATT
CCCCCGTCTACGCCCTGCGCTCCTACTTCTACCTGCTGCTGCACTACGTCGTGGTCCAGCTCACGGCGTTCGGCTCCACGCTCGGTCTGCTGGCCGACCA
GAAGCTGCTGCTGTTCTACGGTCTGCGCGCGGCGTTGGCGCTGCTTTCGGCCTACGCGGAGGCTCTGTTCTACCAATCGACCAGCAAGCGCTTCGGACGA
CGAACTGCTCGCTACCTGCTGTGGATTCTGCTGTTCAACGCTGGCGTCTTCCATGCCAGCACAGCCTTCTTGCCCAGCACCTTCACTATGGTGCTGGTCA
TGCTGTTCGCCAGCGCCTGGATGGACAAGAATCACTACCTTGCTCTGTTCTGGGGCGTTGTGGCGGTACTCTGCGGCTGGCCCTACGTCGGTGTTCTTTT
CATCCCGTTCGCAGTCGAGACGCTTTACACTCGGGGACTGATCAAGAGTATCCTGGTTGGCGCAGGTATCGGCGGCGCTGTGCTGGCGGTGGAACTGATT
GTCAACTTTCATTACTACCAGCGATGGGTACTACCGGCGTGGAACATTGCGGTGTACAATGTGCTGAGCAACGAGACGGACTCGACGCTGTACGGGACGG
AGCCGCTGAGCTACTATCTGCTGAATTTGGCTCTGAACTTCAACGTAGTGGCTCTATTGGCAGCTCCGGCGGTGCTGTTCGTATTCGCGTTGCCCAGCCA
TTACGAGACTGGAAAGCTGCAGTTGGTGGCGTACTTACTGCCTATGTACGTGTGGGTGGCGATCATGTTCACCCAAGCGCACAAGGAAGAGCGGTTCCTG
TCACCGGTCTACCCACTATTTTGTCTGGCTGCTGCGATCACGCTGAGTGCTGTGGTTTATCGTATTGGACGTTTCTTCAGCCATGCTCGTGCCGTGGGCA
ATGGACTTACGCAGCTTATTGTGGTTGGCATTCTTGGGGTCTACTCCCTGCTGTCGGCGTCTCGCGTCGTGAGCAACGTTGTCAACTTCAGTGCCCCTCT
TCGTGTGTACCAGCATCTGTATGCCAACGTGCTACCGAACCCTCACGCTGCAATGCTGCTTGACGCCCCGAACGCTGCCACCCCAACGGTGAATCTGTGC
CTTGTGAAGGAATGGTACCGCTTTCCGACGAGCTTTTTCATCCCGTCTAACAGCACCAAGGTCCAGTTTGTGAAGTCGTCGTTCTCCGGACTGCTGCCGA
AGCCTTTCGAGGAGCACGAGAACGGCACTTCAATCATCCCCGGCGCCATGAACGACCAGAACCGCGAGGAGCCCAGTCGCTACGTGCCCATTGAGAGCTG
TGACTACGTCGTGGACCTGAATCTGCCCGGCCAGCAGGAGACCAAGTTCTGGGAGGAGCCTGCCACTTGGGAGCTCGTGCACTCCGAGCCGTTCCTCGAT
GCTGAGCGGTCCAAGTCGCCCTACCGATCGTTCTACATCCCGATGCTCACGCCGCAGTACGTCAAATACGCGGACTACGCGATCTACAAACGCAAGAAAG
CCGCAGCAAATTAGAGAAATCTGGAAGAACGAGTGCGTGCGTAGGGCAATATATCCTCTCGTAATGGGTAAGTTTGAGGCGATGTCAGGTTGTGTTTCAT
CATATCACCAATCTTTAGTGTTGAAGTTGCAAAGCAAGCTCTGTTAGCAAGCAGCTGAGGTTAAGCAAGCGATGCGCGCGTTAACTCTTAATGCATCCAG
CAGCTTCCTGTCTACTGATTTTCTGTTCGAATCTGGAAGACCTGTTCCAGATCGATCTTCTCCACTGCATCCAGCCGCGTCAGAGCCAGCAGCAGCTCTC
GCTGCGCGCCCTGCACGGCGACGGAGTTGCTGATCCACAGGAACGTGGAGCCGCGGAACAGCTCGCTGTGCCGTGCGAGCAGATCCTTTACCGGCTGCTG
CGTGTGCGCGGCGAAATCCTGGAGCGACTCGGCCACGCACGAGACGCGCTGGGTGCGGCTCAGATCCGCCGCGTCAGCATGGTTGCGGCTGGCCTGCACC
GCCTGAGATGGCGACGTGAGCTGCACCATGACGTCCACGCGCGCCTCTGCGTCGTCGCGGATCGTGCGCAGCAGTTCCGGCGACAGCTTGGACTCCTCCG
CAGCAGCAGAGAGCGACGCCATCGCAGCCAGCACGATGAAGCGCCGCATTGATGAGTGGCTGAATGATGGTCGCAACGGCAACTACCTCTTTGAACGGAT
ATTTATATCTATGAGGTTTCACAGGGTAATCAGAACGCATACAGTAATCTGCCCGAGTAAGGAACGCCTGATATATATAAAGACGCAGAATATATAAATT
GATGTTAAGTTGAGTATACTTTTCCAATGTACTGATTTAGTAATTTTAAAATGAACTGAAGAGCAGCTTTACCTACGAGTCCGGAATGATTCCAACAGTG
GCGTATGGTCGAAGCACTAACCTTTGACCAGGCATCCTCGCACCACAACAGCGCTGTCAACTGGTCGACCTCGTAGGGATTATCTAGCCCTTCACCTTGT
CGAGGATGCCCACTTTCTCAGACCAAGTGAGGCGGAGACGCTTGGACGGTGTGGACTTCATGGGTGGAGTGGGGGAGGAGGTGGGCTTGTGGGGCGAGGT
GCAAAAGAAAAAGTGCGAGTCTACCACTACGATACATGTAGTTTGAAGTCTAGTAAGATCGCTAAATGCGCGCCATTTTTCAAACGAGGGTGGATGATTG
GCACTGGATTTTTCACCTCAGTACCTTGCAGTACCTTGCACATCCCCCTATCGCCACATCGCCTGGAAAATAATATTAAATATGTGAGGCTATTAGTTGT
ACACCCGTTCCTTATTCGGGCAGAATTCTGTACATGTATTCGGCAGGATGACAAGATGACATCCAGAAGTGCAACTTGCGTCAGGTAAACATGGTTTGTC
GTTAAGTTACGCATCCACCTCCGCGTCTTCAGGCGAAGATGCTGTCCAGGAGAACTTGCGGCGCCTGCACCAGGTCGTAGAGGTAGTCTTCTTCCCACTG
CAAGGTGAGTCGCGGGAGGTCGTCGATCAGCTGCTGCTTGAGAGCTGGGGCGGATCGCGCCCCGCAATCGCGCGCGTCGACCGCCCGGAGGCACTGCACC
GAGCAGCCTGCTAGCTGCGACTTGATCGCCCTCGTGTACACGGGGCGCACCAGGAAGCCCTGGCACTCGGTGGCCGACGTCTCCGGCGCGCAGTACTCGC
TGAACTGGCGCAGCTCCTTGCGCGCCACGCACACCTGCAGCCCGTCGTCGAGGTAGCACTCCAGCCAGACCTGGTCGCGGGCGCGACGACGCGAGCCGTA
CATCGGCTTCGTGGAGTGAACCACCCGCGCGATGCTGTTGACTGTGTACAGCACTTCTCCGCTGTCGAGATCGCCGGTGGCTTCGGTGCTCGCTCGCCAG
ATCTGGCGAGCCAGCGGCCGCATCCTCATGCTCTCGAGCGCCTTGGCGCTCTTCCACACGATACGGCTGGATGCATTTTCGTCCTCCTCCTCCTGGCACA
GCAGATGGCGCCAGCCAAATACCTGCCGCACCCTACTGCGGCGTCGCAGGTGGCTGCGGCTGGCGCTACCGTTGAGGTGGCGCAGCTCGCTGGGCACGGC
GTGCATTGCGTGCAGCACTCGGAGGGTGTCGCGGCTCGTCAGGCCAGGCAGCGCGAACTGCAGCGACCTTGGCGAGCCCACGGAGGCGCCAGCGGATCGC
TCGTTCCCCCAGCTGGTTGATTGGTAGCTGGAGTCCACGGCTGCAACCCGTTGGCGCTTGACGCCGCGTCGAGGCGCGATGACCACGCTGGCCCACCGCT
TGAGGGTCTGTTGCTGGTGGTGCACGACGGAGGCTTGGGGCTGTCGCGGCTTGCTGCTTGGTGGCAGCCAGCACATGTCCGAGCCCGAATCGACGCTGTC
TTGAAGTGCCAGCACCGGGCACGTTGCCGCCAGCGCGAATCTGTGTAGATGCAAGAGAGGTGAGAGGACGGAGGGCGATAAACTTTAAGGCCAGTTGCAC
GCTTGCTCTCTGTGGAGGAAGGTGCCTGCACGCACGTTGAAGCGGGTGACTGCAGCTTGCAGCTCCAGGACTGCATTGAGGCGGCGGGCGCCAGCTCGGG
CGAGGATTCGTGCGGACCGGCCTCGGGGTGGTCAATGGGCTGGCAAACGACGCCCATGGCGGCCAGATCGGAAGTGGCGATCTACGAGCGAGCGAATTGT
TCGTTGCAGCTGGCTGGCTGGAGATCTTGCACCAGCAGCTGGGGCAACTTCGAGGTTGCGGCTCGCGCGCTAAATCGAAAATGGGTTGGATGGCGATGGC
GCGGACTTCAAAAAGGGCCGCGCGGGGCGTCCCACTCTTCTTCCAGAAAAAGTGGGATCCTGAGTCCCATATAGCCCTTCCAAACACGATCCAAGCGTTT
CAACGTTACTATCGGAAATGACCTCTGCGAGGCCTATATTTGGTGTCTCGCACACAGTCTCTTGGTCCCAAAATTTGTAGCACGAGCAAAGCCCCCACGG
CACCGAGCAAAGCCTGCAACTTTGCCTGCAACTTCGAGGCTCGACCACCCGCTTTGAAACACACGGGCCAAGCCAGTGGCTTCATGCAGCGTAAAGAGAC
GGCATGGCGCCGCCCACCAGATAGGAGATCTGTTTCCACGGAGCGCGAGTGTGGGTGGGCGCCTCAAAACGCGATGGACGACGCTCGCAGACGCCAAAAA
TGGCAAAGCGCAGCGCCATCGCATTGCTCGCGAACATGGGCGGGGCGTGCGGTACCCTCTGGAAGACTCAGGCCTGGAAGACTCAGGCCTGGAAGACTCA
GGCCTGGAAGACTCAGGCCTGGAAGACTCAGGCCTGGAAGACTCAGAGGGCGCTCCGTCACACGTTGCTGAGTCTGGTCCGCCGGCGCCTGCCGCCCGTG
GTGCCTCGGTGAGCTGCACGGCCCCTCGGACTCCGAGCGCCCGCCACGAAGGTGCCGCATCGGTGATAAGAACCCTTCGCCGCGAAGTTCGCGCGCGTGA
GCAGCGGCAGTGCAGATGGCTGCCGCGTTGAATAATACATGCCTTACATGCCTTACATGCCTGCCTGCACCGTACAGTGCAATCCAGCGCCTCATTCCGT
TGCGGAGACTCTCGAAGCCGCTGCTGGATCGGATCCAGTGATAGCTTCGCTTACGCTTCGATGACAGAAGTAACGGCTACCTGGGCCAACAATGCTGGCT
GAGTCGTTGCCAGCTTCCGGCACCACCGCCGGAGCAGCTCCGAGAATCCAGGTTAGTGCCTTGTCGCCGTGCGACTCGGTCCCGCAGTGCTCACGCCGAG
GGCTTTGCCGCTTGCTCGACGACCGAGTTGATTCCCCAGCCGTGCTGGATGTTCGGGCGAGGGCGCCGCTCTTGTCTTATCCGAAGCTATCGCTGTGAGC
ACACTGTGCAATTCCTGCCGATCCGAGAGTGCGAAATTATGCTAGTTTTTGTAAGTCGCCCGGCCGTGACAAGCCGTGCGTAAGACACTCATGACTCTGG
TCCCCGGCACAAAGCTTGGACCGTCCGATGGACGGGGGTCAATGGAGGCGACAATACTCGCTCACTCTCGAACATTCCTCCGCAAGAGCACGCGCTGGTC
GGAGGACAATGCAAGCAGCTTAGCTCACAGCAATGCCGGCACAACGGGACACAGGCGCCGACTCGCCCGTCAGCGCGAGTGAACTGCTGGACTCGCCCTC
CCACAACTACAACGCGATGCGCGGAGACTCGCACGATATCGCAGATACGCAGGCCCCAGCAGCGCGCGAGATTTTCCGAGCGCCCTCGGAGGCCCAGACC
ATCAGCGACAGAGGCGGCTACTCGTACAGCATCCGCCCCACTGAGACGGACGCCAATTCGCCAGGTCGGGTCACGTTCTCGTATTCCAGTGGAAACAACA
ACAACAGCAGCAGCAGCAGCGGCAGCGGGGTCGGACTGGCTGGCGCTGCCCCCGTGGCGCTGGCTCGTCCGTCAATGATGGAGCGGAATATCGAGGCAGT
GAGCGAACCGACAAGTGCGGGGTTCGCTGCCAAGACGAAGCACTACAGTGGCCGCTATCGGGTGCGTCTCAATGTGATGGTTTTTGTTGTTGTTGATGAG
TTCAAGTCTAACAATCGAGTTGTGCTTGCTTTATGATACAGAGGTGGCCGGGTGTGGTGTTGATCCTGGCGATCGTCATTGGAGGTGTGTTCGCTATCAC
CTTTGCAGCCGTGCACACGCACTCATCCAGCACGGCTCGTCAAGAGGCTTATCAGAAGCGAAAGGCCGGCGCCTCTGCGATCACTGGTGGTGCCAGTGGT
AGCGGCAGTGACCTGGTTTCGGACGACGGTGAAGTGGGCAACCCTAAGTCGTACCCGGACATGGGATGCGAGCTCCCGGACTATCAGAGCAAGGACGGAC
ACATTTACGCTGTCGCTTCGAACGGCACGGAGGTGGCCGTGGACATCAAGGGCATCAATTGGTTCGGCATGGAAACTGGCACAGCCATCCCGCTTGGACT
CTGGGACAACTCTGAGAACGGCACCACGGCGTACCAGATCGCGTACTTCTTGGAGAGCAACAAGTTCAACGCAGTGCGACTGCCGCTCTGCATCAATTGG
ATCCTCACAAACCAGGCGCCCGAGTCGACGCTGATTAACACGGCCGAGAACCGGGCTATCTCCATCACGAGTTACATGTCGCTCCTCAAGAGTCTCATCA
AGGCACTGGCGTGCCGCAATTTCGGCGTGCTGCTCAGTTTGCATACGCTTACGTCGTCG