Description :
From Genome Similarity Track
Location :
scaffold_97:4840- 6193
Transcript NameFunction/comments
Pl_109825hypothetical protein PHYSODRAFT_262124

Sequence
1353 bases(100 bases per row)
TTTGCGAAGACCACGTCGTCGGCGATTGATCTTTTGCTGGTACTTCTGCGCATGCGTCTGCACCTGCTTGATCGAGCGCGTGCCGATAACGGCAGCGATC
GAGCGCCACGGGCCCGTTGGGAACATCTTCATCGCTTGCAGAAACTGTTCGTGCTCCTGCTCGGACCAAAGTCCGCGGGTCACCGGCGTAGCGGGAGCTG
CCGGGACGATTAAACTGCCTCCGTGCGTGCTGGCGGGCATCATGATCATGGCGGTGGTCGCTGCAATGGTTACTGCGGTGGTGCTGCGGAGTGCGCGGCT
CAAGCAAAATTCGGAAGTGAAGCGAACTGCGACCTGATTGATGTGATTAGGCGGAGCAATCTGGTCATTTTTTTAAGTCTTGACACGGTGTCTCTTCTGC
GTGCGAAAACGAGGGGATGGGCGCTTTCGAGAGCGGGTAGGGGTAATTTATGGCTCAGAGCGGTCCTCGATGAAAAAATTGACCAATAGCAGCTGGGCAT
CCCGCCGGCTCGTCTGTTCAGTTCCGGTACAGTGAGCGCGGTATCTCACGAGCACTAAAATTATCGGTCGGTAATTTATGCGCGCATAGTATTTGGCGAG
GTGTGAGAACTGACATGTCCGCAGGCTGCGACCGGCAGCTGGTCGACGCGAGCATGTGCGATGCTCGGCGACTTGAATAGTGAAAAGCACCTGCGGCGCG
CAGTAGTCGCGGCACCAGGCGAAATACAAAAACGCCGCGGACTAGTTGCGGCTCATTCTAGGCTATCCAGCCATGGTAAGGTCAGAGAGGTGCGTGCTGT
AATTCGGCGTGGTAAAATTTGCACTGCCGCACTAAACGAAGCGGCAAAACGCTTGCGGAGATGTCATGCATTTCGGCACGTTCTCCGCTCAAAGAGTAAC
TGAAGTATGTGCGTCGCACTGCGGCTGAATGAGTATTGGTGTAAAGGCTCCGACCTGAATACTTTCGCGTCGTAGTTCCTCGTACGCGTATGTTTGCTCC
GACTTGGGAACTCTAGACGTACGGAAGATCCAGGCCTCTTCGCCACTACAGCGCAGACGTCGGAAAGCTTGGCTCGCGATGATTGCCTCCGGCTGAGTTT
CGCTAGCTCATCGCACAGACAGCAGCATTTGGAGCGACCCGCTGTCTTATCGCATATGTAGTCTTTGGCGCGCCATGCGCCAAACAGTTTGTTGCGACTG
CGATAGCCTTGGAAATGCAAGGAGCTCCACCATACCACAACCAATCCCTGAAAACCAACTGGGCGAGGTCAGCGCAGCGGCACCGTCACGGTGGCGCAAA
ATGGCGGCACATTCGGTAAGATAATTAAATTACTTCTTCAACCTCTGCACGGG