Description :
From Genome Similarity Track
Location :
Scaffold_1705:484- 2151
Sequence
1667 bases(100 bases per row)
TGAAGTATGCTTTGGCAAAATTCAGGGTATACCTACTAGGTGATAGACCCTTCATCGTATACACGGACCATGCGTCCTTACGCACGGCCGTAAAAAGTCC
ACACCTCTCGCAACGAATGGCGAGGTGGATGTCGTTCTTCGCGGAGAATAACTTTTCCATAGAATATAAACCAGGACGACTGAATGTCGTCGCTGATGCA
CTCTCGCGCCGGCCCGAATTTCGAGCCGGATGCGCCACCCGACACTGGTCCGACCACTGTCGCGGTACTGACTTCAAGTGTCCCGTCGTCAACCTTATTG
GAAGACATACGCAAGGCGTACGATCTGGCGATGGTGCGTTTGATGGGTCATCTCTCGTACTCATCCGGAAAGAGCCTCAAACAGTTGCCGTCAGTATATC
GATCCTCTACGGATAGATATATAGTTCGCAACGGCTTACTCCAATATTTGGCTGTTGCCGGCGACACACCTCGTGTCTTCGTACCAGATCATGGTGATCT
GCGATTGCGTATCATTTATAAGTACCACGACGCACCTGCTGGTGGACATTGTGGTCGTGAGAAAACATATCTCACAGTGTGCCGCACCTTTTACTGACCC
CGCCAGTATCAGTTCGTGCGCAAGTACGTTCGGGCATGTGAAGTCTGTCAACGGGTGAAATCTGGTCCTTCCCTTCGAGCCCCGTTACAGCCTCTGCCCG
TCTCGGCCAAGTGCTGAGAATCCGTCTCAATGGACTTTGTCTTTGGATTCCCCGTAGATCCACACAAGAATACAGTTATTCTTGTGTTCGTTGACAGGTT
CAACAAGATGGTACATCTGGTTGCTGTACCCGAATGAATCAAAGCATCGGCTTGTGCCCGTGTCTTTATCGACACGGTCTTTCGCCTTCATGGGTTGCAT
CGTGAACTCGTGTCCGATCGGGACCCACGGTTCAAAGCTGAGTTCTGGCGTTCTGTGTTCAAAACATTCGTAACGCGCTTAAAGCTGTCTACTTCTGACC
AGCATGAATCAGATGGTCAGACTGAACGCGCCAATCTTGTCATCGAGGAGATCTTTCGAGGATACGTCCATTCCTTTACGAATTGGAGCGAATTCCTGTC
AATGGTGGAGTTTGCCATCAACAATTCAGTCCATGCGTCGACGAAGCACACACCGTTCTTCGTGAACGGCTTACGATATGCACTTCTTCCCACCTTTTTA
AAGTGTGACTCTCGTTAAGGAGGTGACTAATTCGAGCGACCGTCAATCCGGGCCTCACTCGTCACGTGCTGACAATGCGGTCACCACAGTCGACGCCGAT
GTCGATCACATCGGCTTTGGTGAAGACGACGAAAGTAAGAGCGAAGATGCTCTTACTGGCCACGATACTGATCAGATCAGCATCACGCCTAGTGCGTCCA
AAGACACACTCATAGAGGCGACAAGTGATCTTGCTACAGTACTCTCCAAAAGCACTACATCCAAATACAGCGAGTCAGCAGATGAATTCATACTGGCTCG
CGAAACGGTTGTCCGTCTCGTACAAGACTCCATTGCTGAAGCAGTGGACCGACAAAAGAAAAACGAAGACAAGAATGGAAAGGCAAATGTTCTTTTATTC
AATAAAGGCGACTTAGTCCTACTATCTACGGTAAACCTACCTCGACACATAGTGACTAACGTGGGTA