Description :
From Genome Similarity Track
Location :
scaffold_749:4839- 6558
Transcript NameFunction/comments
g10138.t1hypothetical protein
g10139.t1 hypothetical protein PHYSODRAFT_469730

Sequence
1719 bases(100 bases per row)
CCTGTTGAAGCTACATTGAAGCTACTGAAGCTGCTCCACTCATCAAGTATGACATGTCGTGGCAACACTTCATTGGGTCCTGCACAGTCTCCGAATCCTT
TGCTTCATAACTCAAATCCCCCTGACAAGTGCACATCAACCCAACAAACGGGAGTTATGACAACTAACGTCAAGGCGATAGATGGCTTCTTTACCAAAAT
CCCCCAAAGTGAAGCTCTGCCGGCGTCTCCGCAGCTTTTCCACCAATTCAAGCTGGCAACTTCATCCTGGACGGAGTTTAAGCAGAACGTCGAGGAACTC
ACCAAAGCCGGTAAAAACCTCAAAGTGGTTTTCTTCGTGCGTCACGGCGAAGGACTCCACAACGAAGCGATCAAGTTGTACGGGTCTGAGCACTGGTACA
AGGAGTTGGTGACCAGCGATGTCTATAGAGACGCAGAGTTAACACCGTTCGGAATCCAAGACGCACAGACCAAGGGACCTCCAAGGATCAGGACGGAACT
CCAGAGAGGAATGCCACCCATTGAGAGAGTCATCGTCTCTCCGATCTCACGAGCCATTCAGACAGCTCAGCATTTCTTCGCAAAGGGCCAGACACCTGAC
GCCCCGTTCGTTTGTATGGAAGGCTGTCGCGAGCACCTCGGAGTGGACACGTGCAACAACCGGCGGTCCGTGTCGGAGCTGAAGATTAAATTCCCAAACG
TCGACTTTTCGGTCCTGACGGATGAGGAGGACGCTCTGTGGACGACTGACCACCGAGAATCGACTGATGAAATCCAAACGCGTGCGAAGGAGTTTCTGGC
GGAGCTCTTCCGAACGATTCCCGAACGTCACGTAGCTGTGGTGACGCATTTCGGATTCATCGAGGAAGTTTGTGCGGTGACGATGGGGGTGAAGATTGAA
GCGGGGAAGTGCGAGGTAGTCCCGATGGTCCTGGAGAAGCTTTAAGCTTTGATAATCGAGCGACAGCTCTTCTATTCCATTACCACTTCGTCACGTATAA
GAGGGATACCTGTATGAAGAATCCTCACCCGTATGTAAGAATTATAAAGACAGGCAACGATATGACCCTGCAACTGGCAACCTCTGTGGTCCCAGAGAAG
TGCTTGAGGACTTGAGTCGACCGAATAATAATGGCATCCGATTCTGCTGATCCAGGTGCATGGGTATGAAGACGTAGAGGAGAAGAGGATCTCGCAATGA
CAGCAAACTCGATCTCGCCGCGGCAACAAACCCGAGGATGACTGCAGCATTGTCAGCACCATCGGAACCTCCCAACGTCGCTTTTTGCCGTCCGCAAAGT
CCGCCAAACGTCGGATTGCTGGGCTTCCGACATGTACACGACTATTGCAGTCGACAGGTTGCTTTTGATACTCGAGTAGAGGAGTCGATTAACGGTGGGA
CCACCTGTCACTAAGTGTCCACCTCTGGTGATTGTCTGTCCCTTACAAAAATGTCCATTAGCGCTCGTGGTTGGTTGAAAAGCGACTTGCGCGACTAGCT
TGGTGAGCTAATGGACCACTGGATGAGCTCAGGATCATGCCGCACCGATCGTCTGGACGGACGTAGCAGTGGCGGGCGCTCAAGTTCCTCACCCTTTCGA
CACCTCACTCTCGGTTTTGACGGCCTCAGCTGAAATCGGGGCCCAAGAGACGATGCTGTCGTCCGAGTTGGGAGGTTTAGCGAGCACCAGCAGCACTCCG
ACCTCCATGAAGGCGGACT