Description :
From Genome Similarity Track
Location :
Scaffold_70:48384- 50831
Transcript NameFunction/comments
Phypl_g2356glycoside hydrolase, putative

Sequence
2447 bases(100 bases per row)
CATGGCGCTTCATTGGTTGGTAAGCACGGCGCTGGTAGCTACCATGCTCACTACAATATAGCAGATCTAGCGCCTCTACAAGGCAGCAGTGCTCGTTTGG
GTGTCGCCTCCAGCcttcacctgctgcgccagcctGTCCGTATCTGAATAACAACAACACGAGCAGAACAACGTCAGACTAAAGAGCAGCATATACTGAG
GCACGATGCAGGAAATACACTTACcagctttcttcttggccgcagcAACGCCAAGGGCGATGAAGACAACCGCCATGACGGCCAGGAACACACCGACGCC
CACGAAAATGGTCTGGGGGGCCGATTTTGAGCTGCTCAGAGAAGCGCACGTGCTAATATCCTTAACGCTGCAGTCGGTGCCCGTGTAGCAGGAGAGGCAG
CTGCACGACTTGGTGCCGTTCGATTCCTTGCATTGGCCGTTGCCACCGCAGTCGGATGTGGTATCGCAAGTACCACCACCGCTGGTGACCTCGTACGTGC
CGCAAATTTTCTCCTGAGTCGTACCAACGGAACTGCTCAAGGTCACATCACACGTGTCACCACTGTCCGTGCAGATCACGCCCTCACGGCTGGAGCAAGT
CCacgagtcggagctggaaATCTTCAGGTTGCtcgccgagcagctgctcACGATCCAGCCGTACTTGGTCGCCGCCGTGTTGGTAGACTGTGTCTTCGTT
TCCACGGTAGGCTTCCACGTGCATATAGTGGTGTCAGTCCACGCTGCATTGTCCGTGTAGCCCGAGTATTTGGCAAACATGGCCTTCAGGTTCGTGTAAT
CCGTCGTGGACTTCGAGCTGGGCGTCGACAAGAAATCCGTGCTTCCACCTACGGATAGAAAGTCAGATTATGAAAATGAGCGATAGCAAAAGGCGCGCAG
CAAGTGTACCTGTGAACATTGGGAACAGCGAGTCCGACGCAAGCTTGGCTTCACCATACGAGTAAGCCAGACCACCAGACCAAACGGCCGTAAACTCCTT
GGTCTTCGAGGGCTcttggtacatgtacggaATCATTCCCCAGTCGCGAGCTTTCGCAGAAGAAGTCTTACAGCCATACTCGccgaaggcgacgacgatg
ggGATACCCTGCGCCATGTCGATGTAGCGCTGGTACGCCTCGGCGAACGTCGAGTCGACACACCAACGGTACTCGTTGATTAGGTAGATATCGATACTCT
CCGCCATTAAACCGTTGGTCATCTTGTCTCCGCAGAGCAGTCCCTGGATCTTAATCACGTGGTAGTCGTCGGCGTTGGAGACCTTACCGTTACTActgtc
ggcagcagcgtagGCGAGCGGCAGAATTCGgatcttcttgccgttgACCGTCATCCAATTCTTCAGATCGGACACGTAGGCCTTGACACACGAGCCGGCC
GTGAGATCGGCCTGCATGATTTCGTTAGCCACGACAACACCCAGCGTGTTGTCGTACTGGGCGAAGTTCTGGAtgatcttcttgccgtactctagcagca
gcgccgggtAGCACGTCTCGGTCTGGTCCACGGTcttggcgccgtcgcccgaggACACTTTCCCGGAGcagctcagcttcttggtgatggTCGAGTAGCG
GTACTTGCCATAGTAGGCGTCGTTGTCGGGCGAGGCCGAGACCATGACGTAGACGCCGAGGTCGGCCATGTCGTTCATGAACTTCTTGTACGAGGACGTC
GGGTTGATGTTGTACAGACGCAGCGTGTTGTACTTGAGGCCCGCGAGGTTCTCCGCGATGATGGCCTTCGAGTACTTGTCGTAGTAATCGTCGCTCACGG
CGTACTCGTACGTCATCTGCGTGGCGCGTACGATACACAGATATTAATTAGCCCCTCTCTATTGAATATGGCGCCGAGCAGTGCTTTGCTGTTAGCGTGT
CCGGCCGCTGGCTCCTTCCTATCCTTGTGAACGCACCCCTttgatgaagaagcgcgcgccCGTCTTGGCGTTGTAGAGCTTGTTGCCGCGCACGACGATC
ACGCCGTCGACGGCCGCGCCCACCGCcctgtgctgcagcagcgcgagggccgccagcacggccagcagcaggaagcttCGTCCGGTCATGGCGTCCGAGG
TAGGTGCGAGTCAGTAGTCGTGGGCAGTCGCCGACTCCGTTTCCGCTATGGCCGGCGGCCTCGAACAGAAATTTCCGCCCGAAATTACAGCTGGTGCACC
CATAGTCATATAGAGGGGTCCATGTCAGTGATAGTGTATCGGCTATTGGGACTGCACCATACTGAAAACAGCTGGACCTCTTGTTTCGAATCGTTTTCAT
GTTGATAGAGGATTCAAGGTTATCGGTATTCATAACGTGCGTGCGATTTGGCAGGATCGCCGATTGGACGAAATTACCATGTCTGCTTATGATTGGTCAA
GAACGATTGCGAATGCAGTGTCTGCTACTTTACCCACTCGAAATACT