Description :
From Genome Similarity Track
Location :
Scaffold_41:483819- 485156
Transcript NameFunction/comments
Physo_108905L-aspartate oxidase
Physo_135928asparagine-linked glycosylation 9 protein isoform a

Sequence
1337 bases(100 bases per row)
ATCCCCGACGAGCGCCGCTTCCTGCTGACTGAGGCACTGCGTGGTGAAGGTGCCATCCTGCGCAACAAGAGTGGGCGCGCTTTCGCCAAGGACTACCACC
CCGACGGTGAGCTCGCCCCGCGCGACGTCGTGGCCCGCCTCATCCTGGCCGAGATGGAGAAGCAGGACGAGCCCTGCATGTACCTGGACATCTCGCACGA
GGACGCGGACTGGATCAAGAACCGCTTCCCGACTATCTACAAGCACTGCCTCGACCGTGGCATCGACATGACCAAGGAGCCGATGCCTGTGGTTCCCGCC
GCTCACTATCACTGTGGTGGTGTCGAGGTTGACCTCCAGGGTCGCACTACCGTTCCTGGTCTGTACGCCGCGGGCGAGGTGAGCTGCACCGGTCTCCACG
GAGCCAACCGCTTAGCCTCGACCTCGCTACTTGAGGGACTCGTGTGGGGCTGCAGCTCGGCTGACGACTTTATGGAGCGCAGTGAGAAGCTCAACTCGGA
GAGCTCAAAGAAGGAGGACGATCCGTTCGCCAACCTGAACGGCTTCCGCGACCCGTACCCGAACGAGATTGAGGAGGTGATGCTGGCGACCCAGCGCATC
ATGTGGGAGTCCGTTGGCCCGATCCGCACGGCTGCCGGCATGGACAGCGCCGTAGACAAGCTCGCGCTGCTGGAAGTCAAGGCCGACAAGCTGCACCAGG
AGTGCCGTGTCACGCGCGAGACCGCTGGTCTGCGTAACGCTGTGCGCGCGGCCAAGGAGATCGCTTTGGCTGCTCTCAACAGCCCGCTCTCTGTGGGCAC
GCACTACGTCGTAAAGGAGTAAGCGACCACCACGATCCCCGTCGCTGTTTACCTTTTAGTCTGCACTGTTGCTCAAGCTACAGATGTGGACCTGCACTTG
ATAGTCGACATCTCAGCTTCGACATGAACTTTAAGCTTTTCAATTCCAATTCAACTTTGCCAGCACTTCAACCTCAGTTTGTGTGTTGTACACCACATAA
TGTTTGCACACATTTCCTTGCAACATCCGAAGGTATCCCGTCCAAGTCAATGCCGACTCGACGCGTCACCAAGTCAGAGGCGAAGGCGTCGGCCGCCGCC
GCCGCGCAGGTGCGCAACGAGCAGCTGGATGAGCGTCAGCTGTGGCTGCCCTCGCTGGAGACGGCGCTGTCGCTGCTGGTCCTGCCTCGCGCCGTGTCGG
CGTTGCTGAGCCCCATCGCGGACTGTGACGAGACGTTCAACTACTGGGAGCCGCTGCACTACCTGCTCTACCGCTTCGGCTTCCAGACGTGGGAGTATTC
CCCCGTCTACGCCCTGCGCTCCTACTTCTACCTGCTG