Description :
From Genome Similarity Track
Location :
Scaffold_140:48375- 49779
Sequence
1404 bases(100 bases per row)
CCGGATCTGGCTCGATCCCCGGGTCTTCGCCCGCGCTTCCAACATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGTTCGGACGACGTGTCGGAC
CCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGAATCCATAGTGCGCGACCTTTCTCCGGTGATGGACT
TAACTCTGGTAAAGAGGTCCGGCGTCGCGGATACTATGAGATCCAAGTCTAGCTTGAAGATGTCCTCTGCGTCGAACACACCGGCTACGATGCCTGACTC
CGTAAGCAAACGTAATAGATCCTTGACTGTCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTC
AGGATCTGTATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATTCAG
CTTGGTCTTCTTCCGACTCTAGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCGTTCTCGTTTCTTCGATTAGCGGGGTTGGGTTTAG
GTACGGTGCTGGCTTAACCGATCAATCTGCAAATTCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTTGCGGATCTTTGACTTGCGTCAAGATCCGC
AGGGGTCCCCGAGGGGACCTGAGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGA
TCCGCGGATCTTGTTTCATTCAGCAGTGGCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGTTCAATCTTCACTTGAGCATCTTCTTGGGACT
TACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGAGATAAGCAAAATCTGCGAGATTGCTGGATCCAACTTACCAA
CCGCGCCCAGACACCGACAAACGGAGGGGGGCCCCCGATGATCCGTGATCTGCTGAACGTTCCTCACCTTGTGGCCCCGTCGGTAGGGCGGGATCTTGCT
CTCTCGGTAACTTCCGAAGAGCTCAAGTGGTGAAGCTTGGGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGTAGTGATAAGATCTTCACTCTGCGT
CCGTGATTGGTTCTGGATCTTAAGCGAATGTTCGAGTTGGTGGATCCAGGGCCTAGATCGTGTAACGAGCCGTAGGGTTGCCTTGCGGGTGTGTCCCTCG
TCTTTGCGTTTCCTTGGCGTCGTACTTCCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCTAGAGTGTAACCGACCAAGTAGTAAATTCGGTTA
ACCT