Description :
From Genome Similarity Track
Location :
Scaffold_70:4836- 10767
Transcript NameFunction/comments
Hyaar_Emoy2807825reverse transcriptase

Sequence
5931 bases(100 bases per row)
CATGGTGGCTTTAAGACCAAGCATCGACAAGGCTGACGTACCTATTGAACGGAAATTCGTTATAACTTCGCCAAATTGAAGGCCAAAGGCTAGTTGCAAG
CTGCGTTCCGCTCACACTACGCTCCAGCTGTGCCGATAGCTGCGATTCTACATCAGGTTTCGTCCGTGGACCCGCGTACTGCTTCCATTACTGGTGAGAA
GCGAGAGGGATCACAAACTGATCTCGACCATGGCTCTCAAAAAAAACCACGGCATATCGGCAATCTTGCCGAAGAAGTATCTCGAACTCCCATGAGTTCT
CAGACTCAGGGTACCCCCTCCTCTTCACCAGATACTGGTATTGGCTATGAAGACGAAGTCGTTGCAGTAACCTCTCCACATAGAACTGGCGGTTCTCTTG
CTAGTCAAGCGACGCCGGTGGTGGCCGGTGTATCGGCAGTAGCTCATGCGGCCCTGGTTGACGAAGTGAACAGTCTTCGCGAGACTTTAGGTCGGACCCA
GCGCACGCTTGACGCGGTGCAAGCCCGTCTGTTGACGTTTGAGACGAATCAGACACTCTCGGAAACGCATCTTAACCTCCTGATTCGGATGAAGCAACAT
GTGGCAAGGCCAACTTTCGCGGCGCAAGCATATCTTGATCAACCCGGGACAGATACTTTTACGGATTAAGGAGTCAAACGTAAAACACGGGGTGTGTACG
CAACTTTCGAGGTAAGTTAAGAGTACATGCAAGGTCCTTCTTAGCCACGACCGTAAATGTTCCTATGAAGCGAGGACGCAGATTCGTCTTAAGCACAGCA
GATACTACATTAGTAGGTAGATTCTTATCCTTTAGTAAGACTTGGTCACCGATCTCATAACTTTCAATACAGCTTCTGCCTTTAGCACCCGATTTTTCAG
TCTTGCCTACCAGCTATTAATTCACGCACATACCGTAGGATATTTATTCGCGATGTGAGGAACGTGCTAGCCTCTTTTTTACAGTAGCAGGGCTGACATC
AGCAAGCCGATTGGCCACCTCTACCCCACCAATTCTGAACCACGTAGGGGTAGCGTTAACAGAACGTGAGGGGTTAGGCCGTTTACGTAGAATGGAGTAT
AGCCTGTCGAGGTATGAAAGGAATTGTTCGTGGCGAACTCAACGATGAGGAGCATTGAGATCCACCACCAAGGCGTATCAGCGCACACGCTGCATAGGAC
ATCTTCGAGAAAGCGATTAACGCACTCAGTCTGACCATCGGTCTGCGGATGATTCGCTGAAGACATGTCTAATCTTGTGCCGATTATCTTGAAGATTGAT
TCCAAACTTTACCCATGAAACGAAAATCTCTGTCGGAGACAATTGACAGTGTCAGACCGTGTTGTCGAGAGACGCGATCAATGAACAACGAAACTGTACC
TTCAACATCAATGGGGTCCACCACAGCCGCTAATACAGCGATCTTGCTCAAACGGTCAACAAAGACTACAATACTCGTGTTGCGTCCGAATCCTTCGGTA
GACCAAACACAAAGTCCACGCAGATGGACTCCCGACATCCGAAGGGTACAGGAAAACTAGACAGCGGTGCAGCCGCATGTGCTGAGGGTTTGACCCGTTA
GAACATATCACCTGTGCGCTCATAAGTGAATACTTATTTTAGACTTTGGTCCACAAAAAATCTGGCTAAATAAGCCTTAGGTCTTCTCACGACCAGGATC
ACCGCTAAGAGCTGTATTATGGACGTCATAGAGAAGTCGATACTTCAGTACTCCATCATGAAGAACAGTGATACGCGGGGTATCTACCGCATCCGTTAAT
AGCACAACAAGCCGTTATCGATATAATATAGATATAGCCTCGCACGCTATCGTGCCGACAATTTAATGTCCAAGTCCTTGAACGCATCGCTTTCAAGAGC
TCGAAGCAAAGCTGCACATTGTTCATACTTGGCATAATATCCACGGATTAAGTAAGTAACTGACGCCGACAGAATCGTAACATGAGATAGTCATAATCAG
GCCGGTGTGACAATGCATCAGCCAAAATATTTTGTCTCTTCGGGTTATACTTCACCTCGAAGTTGTAATTTTCAAAGAATGAACGCCAACGGGCCATCCT
CTGCAAGAGGTGAGGCGATTGGTTAGGAGAGCGTAAAGGCGCGTGATCGGTATAGACCACGAAGGATTAGAGCCAAGAAGATGAACTCTGAATTTTACTA
GAGCATACCTCATAGCAAGTAGCTCCTTGTCGTGAATTAGATTGTTATTTTCAGTAGCTTTAAGATGACTGGATTCTAAAGCGATGAAACGCTCTCGTTC
CTCGACATCTGATTGTAACAGAGCACAGCCAATAAAAAATCAGAAGCATCAAGACGACACTGAAAGGTGGGTCAGGGTCTGGTAATGCCAAATGGGGGCA
TGTAGAAGACTCTCTTTTACGGCTGAAAAAGCCTCATCTTCGGTCCTAGTACAGCACCACTTCACATCCTTTTTAATGAAATTGTACAATGGTTAAGCCA
TATCAGCGTAATTATCGCTATACTTGTGCAAGTAATTGGCAAGGCTAAGCCACATGCGCAGATCGTTTTGGTTATGAGGAACTGGCCAATCCACTACGGC
CTTCACCCTTGCGGGATCCGCCTGAAGAACGCGCTTCCCAATGAAGCATCTCAAAAATGGGATCTTGTCCGCACCAAAGATGTTTCGCATACATCTTATT
TTTGCACATGCACTCGAGCACAGCTCGCAAGTGGTCGATGTTATTATTTACGTCTGACCGACCCTGTTTTGCACGGCTATGTACAAACATGTCATCATAA
TAAGATTGTGTGTATGCTCGGTGAGTGCGGAACAGTTTCGTCACAGACGATTAAATGTAGCTGGGGCATTAAAAGCCCCTGGGGTATAACTAGCCACTCC
CAAAGCATATCGCTTGGCGTAATACCCGCTGTAAGCGGATATCACTTGCTCGCATGAGCAGTTGATAATATTTATCGGATAGGTCGAGTGCACTGTACAT
TTTACACTCTGTCATGTTGTTCTGAAGAACATCCTTTCTAGGCATGGGTGTTTGTGCTGATATAGTGGCCGCACGAAGCTTATTATAAGCATGGAGAATA
CGCCACTGACCATTGGGCTTTTAGACACAAAATGTCTGTGTGGGAATGAGAAGACTTGCCATCACGTACCATTCCTGCCGCGTACTTAGCACTGAAAACT
CGTCAATGACGTCACATTGTACCTTTAGTAAATACCACTACCGTGTATTGCAGTATTTGGTTCCAGGAACCAAGTCAATTTCATGACGTACACCCCTATA
GGGAGGTAGGACAGATGGTGGATTATGATACTACGTCTTGAACAGCCAAAGTGTAGTGGAGACCTACAGGATTCTTCAAAATGGATTATTCACTATGTGT
ATATACAGTGCCGCCTTTTGTACTCTCAAATACCGTCTCATCCAAGAAAGATGAGGATTTCAACTCGTAGTCGGGTCTACGAGCCACCATATCGGATAAG
TCGCCTGCCTTGAAGTCCTAGCAGAACTCATCAACAGATATTTCGTCCATCTCTAACCGAGCATATAACGATGGGAGGGCCGCAAGGCCGACTTCACCAT
CCACGTGGCTTGTCACTTCATTGACCATTGTATATAGCTGCTTGCTAGTATCACGCAGCAACATCACAGACGCTTTACGTCTTGTACCAGCCATCTGGCG
TCGCTGCCGTCTATGCAAACAGTCAAAACACCTCAACATGGACGGGACCTCTGGTTCTGCAAGTTAGTCGTATCCCTCAACCTTAACTTGCGCTATACAA
ATGCTGATGTCATTATTGACATCCGGTGCAGAGTTACTTAACTCGAACTCATCACCGGCGTCTTATCTGCCATTACACATATATCAAGAAAGTCTGACTC
TTGATATCTGGGCGTCTCGCCACCAATGTCATTACCGACCTTCAATGATGTGCTATGACATCCTCCCTCACTCTTTGGATGTTTACGTACCACTACACAT
GCACCAGAGGCGCCTCGCTCGTGATGCCGGGGCGTTTCACCAACAATGTCATTACCGATATTCAGTGAGGTGCTATTCCAATCGCCGTCACTATGTGGAT
GTTTTCGTGCCACAACACGTACAACTATGAGATCACACCCTAAATGACTCGACATAGGGTCATCAATGCTATCAGCATCCAGTGGTTCATTATAAAATCG
ATTGCCACTCAACAAAATACGTGCCGTCCCACTATCGTCATTGACATCGGAGTCAAGTAACTCATTTATTCCGATGTCCAGCACATTAAATGACTCAGTC
AGTGGCTCACGCCAATAGCGCTATCACTTTCTAGCAACGGTAGGTTCATGAATCCCTAAAGCTCCACTTGAAACATTGTGCGTTTCGCCTAAGGTCTTGG
ACCTCCAATTAATCCATGGATCGTGGCTTTCTAGCCAGACCATATCTAGAAAAGGATCATATCTCGGGTCAAAATTTAGAACAACACAGCTTTCAATACT
GTCAAAGTCTTAAACCTTTACACCTAAGTCCAACAGAGCTTTAGGTACGGTGACGCGGGCCCCAGCTGCTAGAGGCACCGTGATAAAATCTCCTTTGTGT
GCTTTCAGCGCCTCAGCATACCGCTGACTTCCTTTAAAAGAACTGCGTCGGACGTAGTTGCCCATTGCCCCAAATTCAATCAAAATTTACCACGGCTTCC
AAAGCCCTTAATCGTTGCCGAGTGACTTGTATTCACGCTTCGTGGTAACGTCCACAAGGTCATTGGGGATAAGCCCTGTTCAACTCTAGCCCCTAGAACC
TTTACAAAGCCTAGTTCATCCCCAGTTAGGTGCCCGAGCCTACTGGGAGTCGACGTTAGTCCGCGCTGTACGACGTTTTAGTTTTGGAGCGGTATCACGG
CTCGGCCGATTATGTAGCGGTCTAAGCAGTGGACAGTTATGGTGTAGACGCTTTACGCTACTGCACATGTAACATATACGGATGTTACGTTGCTGTTCCA
CAGCTGAATCTCGGCTTTTCTATCATAGGCATGACTGAGTTCTATGGGCTCAGCCCTATCAAACGAAGTCTGGGAATAACCATGAGTATTGTAGCGAGCC
ACTTTAACGTTAAATTCAGCTTTTAACGCTACGTCCACCACCTCTCAAAGGTTGAGGGCTGGACACGAAAAACTTCTGTCCGAGCGACCCCAGTAAGACG
AACTTCGATTAAAATGGCTACGCGTTCTTCCTCAGGTAGAAGATCCAACTGCATATCAGCGAGTAAAGCTTTTAGCTCTTGGACATTGTCCGACAGCTCC
TTTTTCCTTGTGGGGAGGATACGAAACGTGAAAGTACTTGATATACCTAATTAGGCGGTGCGAACACACACAAAAAAATTATCTTAAGCGAATTATACGT
GGAAAACGCAGCGTATACAGACGCATCACACGTCACAGCTCATTCTCTGGCTCTGCCGCCAAGTTTTGATATGGCTAGGCCAACTTTCTGATGCTCAGTT
CGCAGCATAGCGGCCCTCATCGCCATTTCGACTTCTCGAATTCAGAGAAGAAAAATCTCTCCCTCTTTTCCTTCAAGTGCATTTACGCTCAGAACGATCG
GGCGAGCCTTAGGCTCCCCGTCGGGCATACGGATGTAGAATATTGGTATATCCGCCGCCAAAGGCCATAGACCTGTCTGATTAACGTGGCCTCAAACGGC
ATAAAGGCTTCGGCCGCGCATTGAGCACTTCCGGGCCTTGGGCCGCAATATAACCGATTTGTTCACTCTCAATCAAGGCTCTAAGCTTATCAAGCGCTAG
TCATTGCGCCTCATAGAGATGTGATAGGCTTTCCATCTCAACAGAGGATTAGTCATTTTTCGATTTCGGTGTAGGATTGACTACAAGTGTTATATTGTGT
GGTGAAGTGCACAGCTCTTAGTCAAAGGAAG