Description :
From Genome Similarity Track
Location :
Scaffold_155:48358- 53198
Sequence
4840 bases(100 bases per row)
AAAGAAGGGGAGAATCTCCTCCTGTTGATCAGAGAGGTGGAAATGAACTCCGCTATGCTCTAGTCGGAACAACAGCGAGTTGGGATGGCTATCTTAAAAC
TGGGTGGTAGAGCCAGATCATGGCTCTTACGTGTAGCACGTCGGTAGACGAAGCTTTCGCCACATGGGATTTGCTAAAACAACAAATATCCCGGGTGTTT
GCTCCGCCTAATTAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGCCAGGGCAAGAAAGAACCATCGGACTGTGTCCAGGAACTGAGAACTCGCT
GCCATGCAGCTTGATCCCTTACCAGAAATGGTTTTGGTTATCATCTTCATGGAGGGCCTTCGTACGGGCGTGGCTCGAACAGAAGCATTCCGGGTACACC
CCACCTCCTTTGAGGCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAATGCAGCCCGTTTTGGCATCCATGGGTACAACCCAAACTCGGCGAA
CTGCTTTAGTTCATTAAATAGGCTGGAGCCTATGGACCTCAGTCTCGCCGAGATGGACGAAGAAGCAGGGCTTCGAGCTGTAGAACAGCATCGAAACATT
CGACGATGTTTCACGTGAAGAAGCACAAAAAATCTACGACCTAATTGCCCTTTACGCAGGGCACGCCAGGTTACTTCATGCCAGACTCCCGCCGCTAACC
AGAAGTCTGGTACGGTGCAAAAACGTAGACTCCCAGTAGGCGCGGGGTGTCCTGCTGGGGAAGAACTAGGTTCTGTTGAGCCTATAGGAAGTAGTGGCGA
GCAGAATTTATTCCCAAGGAGTGCCGTGCACTCTAATACGGGACTTGAATACAAGCCAGGCTTGTTGGTCGCAAAGGCGACTGTTAAGGGCTTTGGCAAA
CCCTGGTCGATTTTGGTCGACTCTGGAGCATCCGGTAATTATGTCAGACGCTATTCCCTTGAAGGGAATCCACGTTATGATGAGGCGCTAGAAGCGCACA
GGGGTAATACGATCACTGTTCGCTTGGCGACAGGAACTCTAGTCACTGCATCCAAAGTTCCTGTGAACTTGGGTGTGAAGTTTTTCGATTTCGATAGTAT
CAAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCATATTCTTGGTATGGCTTGGCTTGAGCGCCATTAGCCATGGATCGACTCAAGGTCGAAA
CATTCGGTGCCACGCGCACTGCCCCTAGTGAAGCTTTGGAGAGATATGAACCCACCTCTGCTAGGAATCAGAAGCGTTATTGGCGCGAGCCATTGGCTGA
CAATGTCAGTGTGCTGGACATCGGAATGTCAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGATAAAGCTCGATATGTGATAGTGAAGCGGCA
CGTACTCCGCTAAGTGATATTCGTTGTGAGAGAAACGTACTGAATGCTGAAAGCATTGTTGACCAAGCTTCAAGTCATCGAGGGTTGAACCCATCAGATG
AGCGTGGAGTGGCACGTAAGTACCCACTGAGTGACGTTGGCTGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGCTGGTGAAATACCAAGGCATTC
CGATTCCAGCTCAGCGGATGCACGTGAAGTGGCAAGTAATCCACGTGATGACGACGTCATGTCCAATGACTCGTCATCGGATGTCAATAGTGACGTCAGC
TCTAGTTTAGGGCAATTTACGTTCGATGATGGTATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGTGATGATGACTGTCAGCTGT
ATACACTCGTCAACGGAGTTACTGGTGTCTGTGATGGTACAATTAGCCTTGAGGCTATACCCTCGTTAAGTCGCTTTTAGAACTCGAAGAGTTGTCGGCG
ATGAGTTTGATCACTCACTAAAGAATGGAGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATCATAGAGCTGAACTCTTCTTCACTTTTGGATGAAGC
CGTTCTGGATGACACGAAAGTAGCACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGAACCTCATGATCTCTTTTATTCCTTAGTCAAGGAATTTCAA
GATGTGGTGTGCCACGATCCACCGTCTGTTCTACCTGTCGATAAAGGTGTCCGCCATGAAGTTGACTTAGTTCCGGGGACGAAATACTGTATCACACGAC
AGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTTCCATGCTAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCACATTTGAC
ACCGACATTTTGTGTAAAAAGCCGAACGGCAAGTGACGTATTGTGCATGCTTATAACAAGCTTAATGCGACTACTATTCCGGTACAGACACCCATTATTC
GAAAGGATGTTCTTCAGAACAACATGGTTGATTGTACTATGTATAGAGAACTAGACTTGACCGATGGATATTACCAATTGCTCATGCGAGCGAGTGATAT
TCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATGGGAATGGCTGGTGATACCCCAAAGGCTGTCTAATGCTCCGGCAATATTAATCTTCTGGTGA
CGCAACTTGTCCACCCACATCGGGATTACGTACAGACGTACTTTGATGGCATTTTTGTCCATATTCGTGCCAAACAAGGTCGGTCAGATGTTGAAAATCA
CATCAGTCATTTGCGAGCCGTGATCGAGTGCATGCGCACTAATAAATTGTACTTCAACGCGTCTAAATGAATTTTTGGTGCAGAGGAGATTCCTTTTCTC
GGATATTTCATTGGTAAGCGCGGCCTTCGAGCGGACCCCACTAAGGGTATAGTGGACTAGACGATTCCTAAGAATCAAAAGGAATTGCGTAAGTGGCTTG
GCCTTGCCAATTACTTACACAAATACAGTGAAATTTACGCTGATATGGCTCGGCCATTAACTGATATCCTTAAGAGGGTCATAGATTGGCGCTGGGACAA
CACCCATGCCGACGCATTTTGGCCAATCAAGGAGAGTCTTCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGTCTGCGAT
GCATCCGACTTTGCCATCGGCAGCGCCCTGTTACAAACAGATGCTTCAGGCCGCGAGCGAGTTATCGCATTTGAATCTCGTCAGATGAAAGCTGCTAAAA
AGACCATTCCAGTTCATGACAAAGAGCTACTTGCTATGAAATATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCAAGCCATTCGTCGTCTATAC
GGATATTGTGTCATTATGCACGCCGACACAGTTGCCTCACCTCTCTCAGAGAATGGCTCGGTGGATTTCCTTCTTTGCGGAATATAGCTTCGAGGTGAAG
TATAAGCCAAGCAAGCAAAATGTGTTGGCAGATGCCCTCTCTCGCAGACCTGATTACGAGCTTGCTCATGTCACGACTTTGACGTCTCCTATTAAGGAGT
TAATTCGTGTGGCATATCCACGAGATCCTTAGTGGGTGTTATTGTTTCATGCCCGTGGGATTAAAAGATACAAGGAATCGGAAAGTCAATTTTCTGCACG
CTTGCGGGCCAGCCTACATCAATAATTCCATCGATAATGGCCTCTTGTGCTATCGCACAGATTTTGCGGATACCGCTCGCATTGTTGTACCTCACGATGA
GGATTTAAAGCATCGAATCCTCTTTGAGACCCACGATACTGCCCTCAGTGGGCATTTGGGCCGGGAAAAGACTTATGGCTCTGTGAGTCAACACTACTGG
TGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCGTACATGCGAATCGCGCCAGCGGGTCAAACACTCGGCACATTCGGCTACGCCACTCGCCAGTT
TACCTGTTCCCACGGGGTGTTGGGAGTCAATCAGTATGGATTTTGTGTTTGGTCTTCTCAAAAACTGTGACGGCAATACGGGAATTGTGGTCTTTGTTGA
CCGTTGAAGCAAGATGGATCACTTGGCAGTGGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCGGTCGTGTGTTTCGTCAACACGGG
TTGCCGCTAGCAATCATCTCTGATAGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTCCATCTTCAAGGTGCTTGGCACGCGATTGGACATGTCCACAG
CGGATGATTTGCATACCGATGGTCCGACTGAGCGAGTTAATTGCGTCATTGGTGACGTTCTTCGCAGTGTTTGTGCTGAGTCGCCACGGACTTGGAGCTC
GATGCTCCCGGTTATTGACTTTGCGTTGAACAACGCTGTTCATGCCTCGACCGGTTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGCATTTCG
ATCACGTTACCACTACGTGCTTCTGAGCTTGTTGGTGGAGAGTCTGCTGACAAGCTTGCTGAAATCAGCCCTACCACGATGCAGAAACAAGTGAACGGGT
TTCTCGCGACACGCTCTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGCTAGCCAGGACAAACAAACAAAATAAGCTGATGCTAAAAGCAGAGGATG
TATTGATTCTTATGAAGTTGGAGACCAAGTCTTTCTAAATGTTAAAAACCTACCTACAAATGTAGTGTCTGCCGTCTTGAAAACGACAGACACTACATTT
GTAGGTAGGTGCGCCCGCGCTTCATTGGGCCGTTTACGGTCATAGCAAAGAAGGGCATTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCACACACCC
AGTGTTTTGCGTTGGCTTGCTTAAGTCATATCATGACCCT