Description :
From Genome Similarity Track
Location :
Scaffold_155:48352- 53198
Sequence
4846 bases(100 bases per row)
GAGGAAAAAGAAGGGGAGAATCTCCTCCTGTTGATCAGAGAGGTGGAAATGAACTCCGCTATGCTCTAGTCGGAACAACAGCGAGTTGGGATGGCTATCT
TAAAACTGGGTGGTAGAGCCAGATCATGGCTCTTACGTGTAGCACGTCGGTAGACGAAGCTTTCGCCACATGGGATTTGCTAAAACAACAAATATCCCGG
GTGTTTGCTCCGCCTAATTAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGCCAGGGCAAGAAAGAACCATCGGACTGTGTCCAGGAACTGAGAA
CTCGCTGCCATGCAGCTTGATCCCTTACCAGAAATGGTTTTGGTTATCATCTTCATGGAGGGCCTTCGTACGGGCGTGGCTCGAACAGAAGCATTCCGGG
TACACCCCACCTCCTTTGAGGCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAATGCAGCCCGTTTTGGCATCCATGGGTACAACCCAAACTC
GGCGAACTGCTTTAGTTCATTAAATAGGCTGGAGCCTATGGACCTCAGTCTCGCCGAGATGGACGAAGAAGCAGGGCTTCGAGCTGTAGAACAGCATCGA
AACATTCGACGATGTTTCACGTGAAGAAGCACAAAAAATCTACGACCTAATTGCCCTTTACGCAGGGCACGCCAGGTTACTTCATGCCAGACTCCCGCCG
CTAACCAGAAGTCTGGTACGGTGCAAAAACGTAGACTCCCAGTAGGCGCGGGGTGTCCTGCTGGGGAAGAACTAGGTTCTGTTGAGCCTATAGGAAGTAG
TGGCGAGCAGAATTTATTCCCAAGGAGTGCCGTGCACTCTAATACGGGACTTGAATACAAGCCAGGCTTGTTGGTCGCAAAGGCGACTGTTAAGGGCTTT
GGCAAACCCTGGTCGATTTTGGTCGACTCTGGAGCATCCGGTAATTATGTCAGACGCTATTCCCTTGAAGGGAATCCACGTTATGATGAGGCGCTAGAAG
CGCACAGGGGTAATACGATCACTGTTCGCTTGGCGACAGGAACTCTAGTCACTGCATCCAAAGTTCCTGTGAACTTGGGTGTGAAGTTTTTCGATTTCGA
TAGTATCAAACGCTGTTTAGTCCTTGATTTGGACTCGAGATATGATCATATTCTTGGTATGGCTTGGCTTGAGCGCCATTAGCCATGGATCGACTCAAGG
TCGAAACATTCGGTGCCACGCGCACTGCCCCTAGTGAAGCTTTGGAGAGATATGAACCCACCTCTGCTAGGAATCAGAAGCGTTATTGGCGCGAGCCATT
GGCTGACAATGTCAGTGTGCTGGACATCGGAATGTCAGTTAGTTGATTCTGACGATGTCAAAGACATGAGTATAGATAAAGCTCGATATGTGATAGTGAA
GCGGCACGTACTCCGCTAAGTGATATTCGTTGTGAGAGAAACGTACTGAATGCTGAAAGCATTGTTGACCAAGCTTCAAGTCATCGAGGGTTGAACCCAT
CAGATGAGCGTGGAGTGGCACGTAAGTACCCACTGAGTGACGTTGGCTGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGCTGGTGAAATACCAAG
GCATTCCGATTCCAGCTCAGCGGATGCACGTGAAGTGGCAAGTAATCCACGTGATGACGACGTCATGTCCAATGACTCGTCATCGGATGTCAATAGTGAC
GTCAGCTCTAGTTTAGGGCAATTTACGTTCGATGATGGTATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGTGATGATGACTGTC
AGCTGTATACACTCGTCAACGGAGTTACTGGTGTCTGTGATGGTACAATTAGCCTTGAGGCTATACCCTCGTTAAGTCGCTTTTAGAACTCGAAGAGTTG
TCGGCGATGAGTTTGATCACTCACTAAAGAATGGAGACCTTTCAGAGGTGGTGGTCATTCGACCCGACATCATAGAGCTGAACTCTTCTTCACTTTTGGA
TGAAGCCGTTCTGGATGACACGAAAGTAGCACTCAGTGCGCGTAGTGGGTCATCAATATTGAAAGAACCTCATGATCTCTTTTATTCCTTAGTCAAGGAA
TTTCAAGATGTGGTGTGCCACGATCCACCGTCTGTTCTACCTGTCGATAAAGGTGTCCGCCATGAAGTTGACTTAGTTCCGGGGACGAAATACTGTATCA
CACGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTTCCATGCTAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCACA
TTTGACACCGACATTTTGTGTAAAAAGCCGAACGGCAAGTGACGTATTGTGCATGCTTATAACAAGCTTAATGCGACTACTATTCCGGTACAGACACCCA
TTATTCGAAAGGATGTTCTTCAGAACAACATGGTTGATTGTACTATGTATAGAGAACTAGACTTGACCGATGGATATTACCAATTGCTCATGCGAGCGAG
TGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATGGGAATGGCTGGTGATACCCCAAAGGCTGTCTAATGCTCCGGCAATATTAATCTTC
TGGTGACGCAACTTGTCCACCCACATCGGGATTACGTACAGACGTACTTTGATGGCATTTTTGTCCATATTCGTGCCAAACAAGGTCGGTCAGATGTTGA
AAATCACATCAGTCATTTGCGAGCCGTGATCGAGTGCATGCGCACTAATAAATTGTACTTCAACGCGTCTAAATGAATTTTTGGTGCAGAGGAGATTCCT
TTTCTCGGATATTTCATTGGTAAGCGCGGCCTTCGAGCGGACCCCACTAAGGGTATAGTGGACTAGACGATTCCTAAGAATCAAAAGGAATTGCGTAAGT
GGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAATTTACGCTGATATGGCTCGGCCATTAACTGATATCCTTAAGAGGGTCATAGATTGGCGCTG
GGACAACACCCATGCCGACGCATTTTGGCCAATCAAGGAGAGTCTTCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGTC
TGCGATGCATCCGACTTTGCCATCGGCAGCGCCCTGTTACAAACAGATGCTTCAGGCCGCGAGCGAGTTATCGCATTTGAATCTCGTCAGATGAAAGCTG
CTAAAAAGACCATTCCAGTTCATGACAAAGAGCTACTTGCTATGAAATATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCAAGCCATTCGTCGT
CTATACGGATATTGTGTCATTATGCACGCCGACACAGTTGCCTCACCTCTCTCAGAGAATGGCTCGGTGGATTTCCTTCTTTGCGGAATATAGCTTCGAG
GTGAAGTATAAGCCAAGCAAGCAAAATGTGTTGGCAGATGCCCTCTCTCGCAGACCTGATTACGAGCTTGCTCATGTCACGACTTTGACGTCTCCTATTA
AGGAGTTAATTCGTGTGGCATATCCACGAGATCCTTAGTGGGTGTTATTGTTTCATGCCCGTGGGATTAAAAGATACAAGGAATCGGAAAGTCAATTTTC
TGCACGCTTGCGGGCCAGCCTACATCAATAATTCCATCGATAATGGCCTCTTGTGCTATCGCACAGATTTTGCGGATACCGCTCGCATTGTTGTACCTCA
CGATGAGGATTTAAAGCATCGAATCCTCTTTGAGACCCACGATACTGCCCTCAGTGGGCATTTGGGCCGGGAAAAGACTTATGGCTCTGTGAGTCAACAC
TACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCGTACATGCGAATCGCGCCAGCGGGTCAAACACTCGGCACATTCGGCTACGCCACTCG
CCAGTTTACCTGTTCCCACGGGGTGTTGGGAGTCAATCAGTATGGATTTTGTGTTTGGTCTTCTCAAAAACTGTGACGGCAATACGGGAATTGTGGTCTT
TGTTGACCGTTGAAGCAAGATGGATCACTTGGCAGTGGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCGGTCGTGTGTTTCGTCAA
CACGGGTTGCCGCTAGCAATCATCTCTGATAGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTCCATCTTCAAGGTGCTTGGCACGCGATTGGACATGT
CCACAGCGGATGATTTGCATACCGATGGTCCGACTGAGCGAGTTAATTGCGTCATTGGTGACGTTCTTCGCAGTGTTTGTGCTGAGTCGCCACGGACTTG
GAGCTCGATGCTCCCGGTTATTGACTTTGCGTTGAACAACGCTGTTCATGCCTCGACCGGTTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGC
ATTTCGATCACGTTACCACTACGTGCTTCTGAGCTTGTTGGTGGAGAGTCTGCTGACAAGCTTGCTGAAATCAGCCCTACCACGATGCAGAAACAAGTGA
ACGGGTTTCTCGCGACACGCTCTAGTGTCTTACGACATGTGCGTGATGCAATGGCTGCTAGCCAGGACAAACAAACAAAATAAGCTGATGCTAAAAGCAG
AGGATGTATTGATTCTTATGAAGTTGGAGACCAAGTCTTTCTAAATGTTAAAAACCTACCTACAAATGTAGTGTCTGCCGTCTTGAAAACGACAGACACT
ACATTTGTAGGTAGGTGCGCCCGCGCTTCATTGGGCCGTTTACGGTCATAGCAAAGAAGGGCATTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCAC
ACACCCAGTGTTTTGCGTTGGCTTGCTTAAGTCATATCATGACCCT