Description :
From Genome Similarity Track
Location :
Scaffold_40:483461- 491495
Sequence
8034 bases(100 bases per row)
CTACCTATAACTATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTA
CCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGA
TGGAGGCCCTGCAGAGCCTGGTGGTCTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGTATGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAGCTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGGGTGTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTCTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTA
GTGGGAAACCCATTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCA
CTCTTGAAGAGGCGGTTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCC
CGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAG
CGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAG
GGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCTAAGAGTCTTCGC
ACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGT
CGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACT
GGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATG
GATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGT
CCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGT
CGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGTCGGACAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTA
GTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGG
AAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGG
TACAACAGTAGCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAA
AGACACCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGG
TGGAAGAGTGTTATCACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCTACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAA
CCTCGAGGAAATGTCGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTG
AACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGG
TGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCC
CGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTG
CGGGAATCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAA
CGGTGCCGGCCCAAACACCGATCCCACGAAAAGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATAGTA
CCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAAC
GCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCG
AGGGAGGCAAGACGGCCATGGAAGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGT
TTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACG
CCACGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCC
TCCTTCAGAAGGACGTCGACTGGCGCTAGGAGCAAGAGCACCAGAATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCC
GGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATC
TCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTC
ACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCT
GTCCTTCTTCGCGGAATACAACTTCCGCGACGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCC
CACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAA
CGAGCGCGAAGTCCGACTGGCTCTCGTCGCAACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGA
TCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTAGGCCGCGAGAAG
ACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGACCGATACGTCAAGACATGCGAAACATGTCAGCGGGTCAAACCCG
CAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACA
CGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTG
TTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGCTCCCTT
TACTGGGAACTCGTCTGCAGATGTACACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGT
GTGCGCGGCAGCGCCACGTACGTGGTCGTCGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTAC
TTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTTTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCC
AGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATTCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGC
GACCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTA
CCTCTAGACACTATCATCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCG
ACCTTACAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGA
CCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGT
ACGCCGGAGGGGCTCCATACGAACGGACCCCGGCACCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGAAGTGTGCCGC
AGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCGCGGCGGTCCACCCGCAGGGTG
CAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCTCCAGTCCCA
AGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGGAGGCGGTCAACTCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTG
GCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAGTCCACTTCCACGGTGGAGCGGATCCTCAG
GAGCAACGGTGTCGCGGAAGCGACAGTCTCTTCGTGAAGTGGAGGGGTTATGCCCACTTCCGAGACCTCGTGGGAGCCGATTGAACCGGCTCCTGATGAC
TGCCCGAAAGGCTGTCGCAATCATGGAACAGAAGCGGCCGGCAGCTTCGTAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATA
CCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGAT
CACGCTGGTCTAGGATGTGGGACAGCTGCTGATCTTCATGGAGCTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTC
CTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGAAAGAGACCACCCCGGGTCTTGGGCTTCTTACGACAAGTC
GTGAAGTCCTTAAGGGGAATGCGGTGTTGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTT
CATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATA
CCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGG
TCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATGGG
AGCGTCGAGTCTCCTTCTGCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAG
ACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCGTAACGGCCGGACTCTCAGAGCGCACA
GAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGACTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCG
CAGGAGCATCCTGAGTGCTCTCGGACTCGGCATCGTCATTACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTCGGACGGTTGTATGAAGACGA
GGGCGACGGACTGCGGCGCCTGCTTGCCCGCTTGTCCGCAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAATAGCCTCCTTGAGTGCA
GAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGTAGTGCCACGAGGCATGT
TAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAGCTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGCCCAAGTCGAT
GGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTA
GCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGAAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTT
CAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAGCTAACAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACA
ATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAGCTTCCTC
TTGCGCAAGGTGCTGTGTGACCCCGTCACAGATA