Description :
From Genome Similarity Track
Location :
Scaffold_1740:4834- 6459
Transcript NameFunction/comments
Phypl_g14053hypothetical protein

Sequence
1625 bases(100 bases per row)
GCACCCGCAGCACTTGAGGCTCTTGCCGCCTGCCGAGCCGTACGccctccacgtccaccgtcTGCACTTTGCCCTCGCGCTCCACGCCCGGCAGCGACTG
CGTAGCCGGCTGTATCCTCGCTGAagtctccagctccttcatcacTAACAAACCTACCATTTGTTAGAACATCAGCCACATCATTCATTGCCACTGCCTC
CGTCACAAAGCCGGCTGtacctgctgctcttggcgCGCTTGCAGCTCCCAGGTTGTCGTGGCCTTGGCTGGCACCTTGCCCTCGGCGATCAGCGGCGACT
GCCTGGGCggcatcgccaccgccgtcgccatcttctctGGCATTGTCAACAGTAGCACCTACGCCACCAATAAGCACCACGTTAGCCATAGTACTAGCCC
TAGCAGGCCCACAACGTCCACAGCACCTCCTGCCTTGCCTgcggcttgagctgcttcttctgcagcgactTCGCGGACGCGCATGTCCTCAATGTACCTT
AGGACGGCCAGTTCACCGAGGAGGTAGTCAGTCACTTCTCCGCCATCGTTCCTTCCTCCAGGCCAAATGTATTTGTAGCGCGAGTCTAAACACTTGCTGG
ACGACCGCTTGGACGTCCAGCCAACCTTCACGAAAGCTCCCCACACGTCCTTGAACACTGCAACGCCTCCAAGAATGCTGGCTGTCTCCGCAACTGTCCC
CTCCACGCCGGATCGCACGCGACGGCACTTTCTGGTGCTGCCCGGCTCGTCATGCTTGCGCTTTTGTCCGGGCGGCGCTTCCGCCATTATCGGCCTGATT
TACTATGAGAGCGGGAATCGATAGAAGGCTGATACGCGTCGTCTATTCGTGGAAAATATAGAGGTTTACAAATACAATTAGTGTATCATTCGTCTTGTTT
TATACACATTCAAACATAGTAGATATATATTCGTAGAGTATCCACAACAAGTTGAGCGCCAAGATCTGGCGGCTAAGCGTTGCATACACAGTTCCCCTTA
TCCAATACACAGTGTAAGATATAATCACCAGTGCACAGCGTTGTTGATATCACGTTTACGGAGCCATACGGAAACGAAGATATACGCAGCACACGTACTC
AATGCCCTGTATCTCGCTGGCTATGAAGGCTTCTTGGGCATGTGTGGCAACACATATATACATCTATATGTGCGTGGGCGCCTGCGGGTAATCCCAGCGG
CTATCACAGCCAGATATAGAGCCGTAACCTTGTCATTCGCCTCCGTTAGATAATGGCACGAAATCCGAGCGCGGGAGCCACGTGAAATCGAGCACGAAAG
CTCGCGCCGCAAGCATCGCAGGCATCATCCCCGGTCAACGCTGGTGCGTCATCATCCAGAAAATGATCGGTGAGGCGAATAGCTTCGAAAGTTGTTATAT
TTCCGCGGCGGTACGCTGTACCATTTtgttttgaccaatcacaATAGTAGAGGGCACAATCGGCCTCGATCACTCCAAACGTTCACTTATTAGCCAATCA
AAACAACCCCCCTGTGTCTATCAATAGCCAAAAGGGCGATttttgcgcccttttacaTTGATTTGACTTCACTTTGTATAGTATAGTATCGAAGAGCTTA
TAACTGCTcctcgcgaaagggttaa