Description :
From Genome Similarity Track
Location :
Scaffold_303:48330- 50899
Sequence
2569 bases(100 bases per row)
GTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAA
GATCCAATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGGGCTAATAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAA
ATATAATTAAGTTTCCTCTTCCTTGTTTGTCCGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGGGGACGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGG
TCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTCACAGTGACGGGAACTG
GAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCAT
CGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGCTTGACCCGCTGACATGTTTCGCATGTCTTAACGTAC
CGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGCCTGAGAGACCGACAGGAAGGTCTTCGCGACCCAAGTAGCCGCTGGAAGGCGCGTCATGCGCC
TCCGCGAGGATATCGAACTTCAGACCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGGTAATAGAGGAGACCCTCTTAAAACT
CATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCATAAGGAACTTGATGATAGGCGCGACAGCCTCATC
GTCCCGATACGCCATGCGTATCCGATCATATAGATCTGTTGTCACCCGCGTTATGTGGGCCAACTCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGC
ACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAGTCG
CCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGGCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTC
CTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGTCTGGACTGGAACGAGATGACTCGTTCCTGTCCAGCCGTGTCGGCCTGCAGCAATGCA
CATCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGC
TGTCAAAAGCATCCTGGTGCTCTTGCCCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCTCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCACTGTA
CTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCC
CGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCTTTA
CGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTAC
GAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATG
CCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCC
CGGCCATGTTGTTCAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTT
TCCGTTCGGTTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGAGTTCGATTCCCGCACCATGCCTGC