Description :
From Genome Similarity Track
Location :
Scaffold_1567:4832- 8456
Sequence
3624 bases(100 bases per row)
TACAAGCAAGTCGCCATGTCAATGCTTACTAGCCCTGATATTTGCTAAAACGTTTATGATATTGTCGTGGAATTTGATGTCACGAGTGGCGAACACGGCG
GTAATTTGCTACGGCCCTTTGGAATGGCGCGAAGATGCGCTGTGTGTGTATTTAGCGCACATGAAAAACGACCAACGAGGTTCTCGGCCGCGCGACCCGC
GCCATGTTAACTCTAATCCAACAGCTCCAGAAATATGCCCCATCCTCGCTCTTGATAAGCTACGCGTTACTGTGCGAACAGTACATTTGATTAAGCTAAC
TGTGCTGTTGTGCCTTTGTGGGCATGTATTGGGCATGATACCGTGTCGACGCCACTGAAACGCACATATTTCCTGGCCATGACCAGTCCGAACGGTTTAG
AAAAGTGCTGGGAcgcgtgctcaaggcgcCGTCTATTCCAACAGAGCTCGAACGTCGTGATACGGATGCCACTGATATTGGTACCCATTCGATGCGCAAA
CGAGCCTCTACATTTTGTTCTTCGGGGTCCACGGCGTGTCCTCCTGCGGTTGCTGTTCATCTCTAAGGCGGTTGCGCAATGGGAGGTGTTAAGGACCAAT
ATTTAAGacacgatgctgctgatgaCATGTTCGTAGGCCGAACAGTCAGTGGACTTCCGATTTTGCAGCCTGAATTTGCCATTCCACCTCCCCACTTTCC
TGCTAATGATGATTTGGATCAGAAAGCAAAGCGGCTATGCTATCCTGGATTGCCTCAATCCGTTGAATTTCTCGGCGAGGTTGCACTAACGTCGATGATA
TACCATCTGGATTTCCTCCGACAACATCTCCCAGGCAGCCATCCCCTTTTCCAATCGCCTCTGTTTGCCGATGCTGACTTAGTAGTTCATCTGCGCTCGA
TAGTCAAGACGGACGGGCCGGGAATTGATATTCAGCCTACATGTGTTCCACCCCACGTAACGATCCTGAAGGAAGTTCGTGCGGCGCAAAATGCTCTTCA
AAAAGTGATACATAATCGAAAAGCATACATGCAAGAGATTAAAAACTCGCACGACAAGTTATGCGAGCGCTTGATATCCGGTGTCGCTTCAATATTGGAC
GAACGATCTTTTCAATCTGGTGTTCCAACCTGTAATAGCATGGCAGAGTCGATCATGAAGAAGTTAGAGGATGCAGGGACTATTGCACTCCTACGCGCTA
ATGAAAATGCGGTAACTCATAGTGAGCATTGCCAGAGCTTGGTGGCCGCTGAAGAGACGACAGAACAGCCCACCATCGCGCCGAGCGAGGAACTTTCTTC
GTATCCTGTATACCATTCGGGAGGCAACATGCATTTGTTTCCTGAAACCATGAAGCTGCCAAGTAGCACAGCAGAACAAGCATGGGTATATTGGTACTGC
GGCAACGCTACTAAAAGACTTCCCCCtcttcggcagcttcgtccatACGACTTGAGCAATCGTAACCAGCGCAAGCGATTGTGCGAGCTGAAGTTTTAAT
GAAGAAAATCGAGCAGCGAGCAAGCAGCCTTGGCCTACCGACGACCAGAATATCATTTTcagatgctgctgatgtATTCCAGCAGTGCAAAAGTGCCATT
GAGCTGCCGAATGAGACGGAAAACAGCAGAaaacgacgccgaggccaacTCGTATGGGTCTCCGCAGCAACTATCTTACGAAAGCAGGCAAAGACAGCTA
GTATCACTCAAGTAGGATCTTCGAGTGAGAAAAATTGACTGCTTGTAGTGTGTGACTTATCCCGCTTCGATTGAATGCACTATGCAAATTCCTATTCACT
GATGTTGTCACACTCCGAGCTATCAATCGCACAACCAGCTTTTGGGTCGGTAGTCGATACGAATCTATATATCAACTGCTGTCCTGTAAAAACCAACAGC
AGTCCGGTAAATTCCGCCCAAGAGTAAATTAAAAATAGCATCGGGCGAGATCGCcctctcggccagcagccaagcccggccagcagcatcaagcacgacc
aacagcaacaagcccATGCCGACTGCCGCCGCcccgaccagcagcaacagctgGCCATTGTACAAGATGAGCACTCGACGAGTAAAATATATTGTGCAGA
CTAAGACAAAGCTCCCTGTGGAGCTCCAAAGGtgtggcgatggaggagcaggtAGTAACCAATAGCAGCGATTGCGCTCCGAATTCAACAGCTCGATGTC
TCCGAGTGACAGCAACCGCGCAGCGTGTAGATTCTTGAGAGTCCGAAGGGTTTGAGAGGCAGTTGTCTCGAGTGGGGCAAATTCCGTTGTGATTCATTAG
TCCTTATCCAACCACCACTACTACACGAGGAGGGAAGCCCCAGGCATAAAACCCCTTTGGTCCACCTGCCCTGTGGCAGCAGGTCAATCCCTGCCAATAC
TGATGTGACTGATAGGCCTTGACAAGAGCGTGAGTTTCCTGGAGCTAAAGCCGAATGGCTCGTAACCAAAGCGGCGACGAATTCTACGGTCGCGTCAAAA
ATTATTCGAAGACATTCCCGTGGCAGTAATATAGCAATACCGGTAGAAGAATCACCTCGAATCGATGCCAAAGCTAAAATAAACAGGTGGTTTGCTTGCC
AAATATTGGATAGCAATGGCATTACCGCTGCTGACACTCTTATCCAACGCAATCCAGATCGATGCATATCAATTTTAGAGTAATATTGCCCAACAGTGTA
GCGTCTACACTGTAGACCACGAGATTCCTACATCATATTCGAACTTAGAAAGCGAGTATCGTGGTTCCTGTCACCTGCATCACAAACAAATCCGAGTCAA
TAAGCAGAAACAAATTCCATGAGAACTTTGGTCGATGTTGAGCTTTTACACTTGCGGATTTCATACAGCCCGCAGACTGAAGGCTGCACAAATACCTAGT
CTTCGGACAGACTAAAAAAAACTTCACTCACAGATGGCCAAATTGAAGCTGCAAACCACTCCGTCGTTTCATGCTGTCAAGCGGGTCGAAAGAATGGCAT
CAGGTAAATTCAGCAGCAAAGATAAGGCCACACCGTGGCCCGGGGCCAACGCAGCCATGAACAACCGGTGACAAGCGTGACAGCAACTCCAGGTCCGTGT
CTAGGAGCAAGCCAAACTGGACTTGCAAGAAGAAAGCAGTCGCATTTCAAAGGAGCCGTACGAGGTGGGGCAAAGAGCAGTCCATTCAAAAGTTGAGCCA
GGCCTCAAGGAGGCATCTGGAGGGCCGTGCGAAGATCACTCGTGTGTCGGAGCGGCGGCCCAAGGGGTAGCTCTGAGAGGCTACCCCCAGGGGTGGTGGG
CGGGTTAAAAGCGAGCGAGGTCTCGATAGCTATtccgctgctcttctcctcggcgcgAGTCCACTGGTTGCCCCTGATGAGCGGTCGGATAGTCCCGCTG
GCCACAAGGCCGTGGCGCATACGCTGGAGACGCGTGCGCCGACCCCCCGTACGAGCCATACTGATACGGCTGGGAGTACGCGTACGGTTGAGTCTCCCGA
TAAGGCGCTCGGCCAAAGACCTGGGCCTGAAAGTCATGGAGTTGATGCCGCAGGTCCTCGACCTCGGAGGTCAGAGCACGGCGATCGATCCGCTCATGGA
GATCGTGATTCTCCCGCTCAAGTA