Description :
From Genome Similarity Track
Location :
Scaffold_15:4832- 7801
Transcript NameFunction/comments
Phyke_g1303hypothetical protein PHYSODRAFT_559234

Sequence
2969 bases(100 bases per row)
GGCTATTGCAGCAATTTGGTCATCACGTCACGCTTCACAGTGTACAATTTCCTGCCCAAATTACTCTTTTATGAGTTCAGCAAACTGGCCAACGCCTATT
TCCTCATTATCTCCATCATGCAGACCATCAAGCCCATCTCCAATACTGGAGGGTTCCCAGCGTCTTTACCGGCTTTGTCTATTATTGTGCTCATCGACAT
GTTCTTTGCATGTCTAGAGGACTATAAACGCCACAAGGCCGACCATATCGCCAATGAGTTGCCATGCAAGAGATTTGTGAAGGAGACGCGCACTTTTGAA
CCTTCCAAGTGGCATAAACTACAAGTGGGGGATGTCGTCAAAGTGGCGAATCGGGACCCAGTGCCTGCGGATTTAGTGATTTTAGGAGCCTGTGAACCGG
AGCCGCAGAATCCCGCAGGCATTTGTTATGTGGAGACCAAGTCACTGGATGGAGAGACAAATCTGAAGCTCCGACAAGGACTGGAAGCGACGTACACAGC
ATTACTGAATGACGCAGCAGTCGGGGATCTGAAGGGACAAGTAGTGTGCGAAGCACCCAACAACGCGATTCATCGCTTTAGTGGGTCCATGACGCTGGAC
GGGGGAAAGAAAGAGGTGATCACAACTaatgcagtggtgctgcGCGGCTCCACGCTGCGCAACACAGAGTACATTTATGGACTAGTCGTGAACACTGGCC
CAGATACGAAAATCATGATGGCGTCTTCCTCAGAAccgatgaagtggagcaacaTGGAGAGGAGGCTGAACAGGCAGATTATGTACATCTGTTTACTCAT
GGTGGTGCTCTGCATGACGGGTGCGATCACGTCGACGATTTGGAATTGGCAGAATCTGAGCAAACACGTCCGCAAAAACGCGTGGTATCTATTTGATGGA
AACTCGACTGCCGTGAAGTCGCCAGTGGGCAATTTCTTCGTAATGGTGCTGTACTACTTCCTACTGCTCAACTCCTTCATTCCCGTGTCACTGTATGTGA
GTATGACGTCCGTGAAGTTTATGCAGTCGTACTTTATGAACAACGACCTTGAAATGTATCACGAAGAAACAGACACACCGTGCCAAGTGCGCACCATGTC
TTTAAACGAAGAGCTTGGCCAGATCGACTACATCTTCTCGGATAAGACCGGTACACTGACGTGCAATATCATGGAGTTCCGCAAGTGCTCCATCAATGGC
GTGGCGTATGGTCTGGGTGAGACTGAAGTGGGTATCGCGGccaagaagcgacagcaggaagaagtgccttcatcatcttcattttACGCCGTGACTCCTG
GCGGTGGCTCTGCGGTTCCTATGAGAAAGGATCGTGTTGATACTGCACCGGACTCAAACAATCCACCAACAGATCGAGTGGTGAAGGCCCCCTTTGTGAA
CTACCAAGACGATGCTATGTTTGACGCGTTGTCACAGAAGAGTAGCGATCAGGCAAAGGCAATTGGTGCGTTCTTTGAACACTTAGCCGTATGCCATACC
GTCATGCCAGAAAAGGCTCCAGATTCGAGTCTGCGCTTAAGCGCCTCTTCTCCTGATGAGCAGGCTTTGGTTGCTGCGGCTGGGTGCTTTGGCTACAAAT
TCGTAGGCCGCGGCCCCGGCAAGGCGGTGGTTGAGTACTTTTCATGCGTGGATCACCCTGAAGAAATGAGCTGCAATCAGCCGGTCGCTGATCATCCGGT
CGGAGCTTACGATATCCTGGAAGTTCTTGAGTTCAACAGTACGCGCAAGCGTATGTCGGTGATTCTAAAAGGGCCTCAGGGTGAGCTGAAACTATTCTGC
AAGGGAGCTGATACTGTTATGTACGAGCGCTTGCGGCCGACGACCGATCCGTCTGTCATCCAGACGCGTAATCTGACGCTACAGCACATGGAGCAATTTG
CATCAGAGGGCCTACGTACGCTCGTGATCGGTATGACTGATGTGGACCCAGACTTCTTTGCATCGTGGGTGATCCGCTATCGGACAGCTATCAACGACAT
GCGCCAGATCGACCTGCGACGTAATGGCGAAAATAACGATATTGACAGactgatggaggagatcgagaagaaccTGGATATCTTAGGTGCGACTGCAATT
GAAGACCGTCTCCAAGCCGAGGTGCCCGATACCATTTACAAACTGCGACAAGCATCAATTAAGATTTGGATGCTCACGGGTGACAAGGAAGAGACAGCGA
TCAATATCGGCTTTGCTTGCCGCTTGCTTGCCTCAGATATCGAACGGATTATTATTTCGGCTGACACACACCCAGATTTAAATTCCATCATAGATGAACT
GGAAGCGTACGATCAggatgatgacaacgacgataCCTCTGCGTCAATAGCTGCAGGCGCAATGGGAACTTCGTCAGTGGTGTCAGAGGCTCGAAGCTCT
GTTTCGCTCAGGAATCACCATAAGCGGCTTACGCGCATCGAGAGCATGGCCGAGGCGCGGAAACAAGACTTGGCGCTGATTATTGATGGTGAAACCCTGG
AACTTGCGCTAGAGGAATGCCCAGAACTGCTATTGCATGTTGCAGAAAGGTGCGTAGCGGTGATTGCATGTCGTGTGTCTCCTGCCCAGAAAGCGCAGTT
GGTGCGTCTGGTGCGCGACAACAACCCAGAAATTCGTACACTGGCTATCGGTGACGGAGCCAACGATGTATCGATGATCCAGTCGGCCCATGTGGGTGTG
GGTATctctggacaagaaggtATGCAGGCTGCAAATTCGTCGGACTATGCTATCGCGCAATTTCGCTTCCTATCGAGGCTGCTACTTGTTCACGGACGTT
GGAACTACGTACGTATGGGCGAGCTGATTTTGTATATCTTCTACAAGAATGtgatcttgaacttgacacAGTTCTGGTACATGATCTTCACGGGCTTCTC
GGGGCAGAAATTCTTCCTTGAGTGGGGACTCCAGGGCTACAATCTGCTTTTCACGGCACTGCCTATCGT