Description :
From Genome Similarity Track
Location :
Scaffold_600:4832- 6730
Transcript NameFunction/comments
Phyke_g10566hypothetical protein PHYSODRAFT_310535
Phyke_g10567hypothetical protein PHYSODRAFT_534001

Sequence
1898 bases(100 bases per row)
CCGAAGGACACCAGCAGAGCTCGGATGCCGACTTGGTTGAGCGCGATGCCCAAAAAGACGCCAATGCAGAACAGCACCTTGCTCAACATCACATTGTCCA
GTACCGACGGCAGCGCTGCAATCATAACGAGCACAAAACCGATCGATGCGAGTGACGACCCGGTAAGCAGCATTTTGAACTTGCCCAGATATTCGTCCGC
CACGAAGGCTGCGATGATGCACGCGAACTGGCTTAGTGAGTCGTAAGTGAGTTTCATGGAGTTAGAACCCTTGTTGGACCAACCGAGCTCCTGGAAAAAA
TTCTTGAGCGTCTGGTTGACCCCATAGCCGGCTAGCTCCTCAAACATTGTGAGGATAaaaatgaagatgcagacactCTTGACGACATCTTGGGAGTACT
TCGAAGGGCGTGAGTCCCACAATTTCGTGCTGTAGCTTGTGGTGACCGTCGGTGTAAGCGACTGTGGCGTGAGCAGCGGCGATGGCGATTCATAACTTTT
CCTCATCTTTGGCTGACCGATGAAATTGAATTGTGGGAATATGAAAGCGATGGAAAACTTTTACTGAGCTTATCAGGTGGGGGTATCGATCACGAGAGGC
CACCCGATTTTAGCAGTGGACGCTTTGTGTGCAACATGATGGACTGTGTCTGCGTCCTGCACGTGGATTGTGTACTCTTCGCTCGATCGATTGCGTCCTC
TGGTGGAGGATCATTATTATCCTACCCGTATGTCTGACAAACATCACCAAGCGCCAATAAGCTGCGATTGCTTTAGTGGTCCGGAACACCAAGCCAGGTT
AAAAGATTGTATTGGCTCCTGGGGGACTACAACGCGCTCTACTTGCGCCAACGCGGTGTACGATGGTCTCCGCTGTCACGTGCGAGGTATCCGATGTGTC
CCGCAGCCCATCCACCGAAAGACCCGGTGTGAATTTCGTACTGTGTCATCGAAATTATCATTCAAACCTTTTTGACGCGCGCACAGCAGCGATTTGCTCG
CCAAAAGCATTGCAGCCATATATACAGTGCATACTGTATCCCCTCGTTATGGACCCTCAGAAAATCTTTGATTGTCCATCTATGTGAACGCTGTTTCAGC
GGGTGCAACGACTGGGCCCCATTTCACCAatgcgctgcagcacaaatGCATCGTGGCAGTGTGGTCTCGCGATAATGAAGAAGATATGGGTAGTGCACCT
TGAGCGGGAATACACGTTTGCTATGCAAAAGTGGACGGACGAGTGAGAATGGGATACGTTTAACACACGGGAGAAGGAATAGCGTTGTTAAATTAATGCT
GACAACAGGAAGCCTGCAGGGCTTATCGATACTAGTATTAAATGCGGACATCATGTACAGGTAAATTTAACACACGGGCATACACATTTATTTTTAAAAG
GCATGTGTCCTACGCTGCACTAGGCTCGGGTgttttgctgtcgttgtccTGTTGAGAGGAATGCATACCAAATTGCATCTGgttcatcaccaccacgtag
AAAAAAATGTTCACGATCATAAGAGCGCCCAGTGTGAAGAACATGTACTCGATGTGCCCATCGTTCAGGTTGGCAGGGATATACTTGCCAAAGAGGAGCA
CAATGATCGATAGCAGCGAACTACCCATTGAGTTGACGAAGAACGCGAGGGCGATGGATGAGCTGCGCATATTCTGCGGGACCTGGGAGTAGTTCAAGTC
GTAGGATGGAATTGTGATCAAGACACCCGCAAGCGACACCAAAAGGTACTGCGGTATCGTGGTCCACCACGGAATGTCGTTCATGATTTGGCCACCATCA
TCGTTCAGCAGGTACTGGGTATCACCGTTCGAGTCCACGTACATGAGCGGAGTGGTGCTGCGCCGAATCATCTCGTAAACACCGGTCCAGAACATGGC