Description :
From Genome Similarity Track
Location :
Scaffold_34:483117- 484216
Sequence
1099 bases(100 bases per row)
ATGCGCAGATAGAGGACACCTTCTCCGGGTCGGCGCGAACGCCGTCCTTGCCCACGAAGCAGCCCAGCACCGGAATCTCCGGCGCGCAGAAGATACACTT
CTTTAGGTTCGCGTACAACTTGTTCTCGCGCATCACTTGGAAGACCTGTTTTAAGTGCCTCAAGTGGACTTCTATCGCGCTGAGACCACCCTCAGCGCGG
CTGTGCACGAAGATGTCGTCGAAGTAGCTCGGTGCGAAGTCTCGAAGCGGACGCAGCACATGGGAGACCATGCGATTGAACGTGGCGGGAGCATTCTTCA
AGCCTTGTGGCATCACAAGCCACTCCCAGAGCATACCGCGGGGGGTGCTGACCGCTGTCATAGGAATGTCGCTCGGTCTCATCAAGATCTGATAGAATCC
GTCGGTCAAGTCGATGGCGCTGAAGACGACACTGCCCGCCATGGTGTCGAGCACCATGTCCTTCCGGGGAATTGGGGTTTGCGCGGGGATGGTCGCATCA
TTCAACTTGTTAAAGGCATGAACGATGCGCCATCCGCCTGTGGCCTTCTTCACACAGAACGTTGGGCTCGAATGTGGAGAGACACTCTCACGCACGTGAC
CCGCTTTACGGCGATTCTCGAAGAAGTCGTCGATGGCCTTGACCTGGTCTCGTGGCAGCGGCCACTGCCGCGTCACACAGTACTTCGAACCGGGCGCGAG
ATCGATCTCGTGGCGGACGCCTTGATCGGCAGGCAGTTCGGCTAAAATCTTATCAGAGAAGACGTCCGCGTATTCGCGGACGGTCTCGTACACTGGATTA
CCAGACTCGCGCAAGGACTCCCAGGACTGCGCTGCGAATCGCTCCTCGCGAGCGGACTTCGGTTCGGCGCTCTTGGGACGGGTGGATTCGACGTCAGCAC
TGACGGTGTTTTCTTCGAGTGGCGTAGACGAAGTGTCTGTGATCAGGCAGATCTGCTCAACCTCGCCAACCTTGAGACCACGAAGGAAGTTCTTCCAGGA
GAGACCTGGAAGCCGGGTGATCGATTGAGCGTCGCGAGGTGGACACGCAAGATCGACGGTGCGCTGACGGCCCATGCCGTCATCCACGTGCTCAATGAC