Description :
From Genome Similarity Track
Location :
Scaffold_3:483111- 485386
Sequence
2275 bases(100 bases per row)
TGACGGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTACCCAAGGATAAGAGTACTTGTCACGAGATAGACCTGAAACCAGGGTCAAAGTATTGTGTC
ATGAAGCAATGGCCATTGCCTCGTGAACAATTACTAGCGATTGACAAATTATTTGCCGATCGCTTGGCAGCCGGCCATTTGAGGGAATCTACTTCCCCAC
ATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACAGGTCGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCAACTGTACCGGATCAAACGCC
GATGCCAAGAAAGGATGTCATTATAGATGGTATGGCAAGGAGTCCCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATCCATGTGCGTGAA
AAGGGCATTCCGTACACAGCAGTGAGCACCCCAAGCGGTATGCTTTGGGAGTGGTTAGTAATGCCACAAGGGCCGAGTAATGCTCCAGCTACATTCAACA
GATGCGTTACGAATATGTTGAGATCTGTGCAAGAATTCGCGCCTAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGATATGAATGGACAGACGAATGT
AGAAGTCCACCAACTCCACGGCCGAAAGGTTCTTACACTGATGCGTGAGCATAAATTGTATGCCAACCTCAAGAAGTGTATATTTGCTGTCAGCGAAATA
CCACTTCTTGGATGCATCGTGGGTAAGCACGATGTCCGGCCCGATCCGGAAAAGATCAAGGTGATCACTGACTGACTGAAATACGCCGCTAGGCCAAAGA
ACTTTCGAAAGTTCCTTGGCCTGGCGGCGTATTTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTCTCGCGTTTATTAAAAAGAACGAG
AAGTGGGAATGGAGTGCCGACTGCCAGCGCTCTTTCGAAGGTATCAAGAAAATCTTAATACGATCGCCAGTTTTGGCGATTGCAGACAAAGACAGACCAT
TTCATGTGGTCTGCGATGCAAGTGATACTGCCATCGGATGTGCACTAATGCAGTACGACACAGACGGTGCTGAGCGTGTTGTCTGCTATCAGTCACGTCA
GCTGCAACCCGCTGAACGTAACTACCCAGTCCATGACAAGGAACTCCTTGCCATGAATTATGCTTTGGCAACTCTGGGTCTACCTACTAGGTGATAGACC
CTTCATCGTCTACACGGACCATGCGTCCTTACGCACGGCAGTTAACAGTCCACACCTCTCGCAACGAATGGCGAGGTGGCTGTCGTTCTTCGCGGAGTAT
AACTTCTCCCGTCGAGTATAAGCCAGGATGACTGAATGTCGTCGCTAATGCTCTGTCGCGCCGGCCCGATTTAGAACCGGCTGCACAACCCGACACTGGT
CCGACCACTGTCGCGGTGTTGACGTCGAGTGTCCCATCTTCAACCTTACTCGAAGACATACGCAAGGCGTACGATCCGGCGATGGTGCGTTTGATGCATC
ATCTCTCCCAACCATCCCGTCAATCCCTTAAAAGTTTGCCCCCAGTATATCGATCCTTCACGGATAGATATACAGTCCACAATGGCTTACTGAAGTATAC
AGCCGTTGCCGGCGACACGTTGTACCGGACCTGCGACTGCGCATCATGTATGAGTACCGCGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAAACAT
ATCTCACAATTAGTCGTGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGTAAGTACGTCCGCGCATGCGAAGTATGTTAACGAGTGAAGTCGGTTCC
TTCACTTCGTGCGCCGTTGCAACCCTTGGCCACTCCGGCAAAATGATCGGAATCAGTCTCAATGGACTTTGTCTTTGGATTCCCCGCAGACCCACACAAG
AATACAGGTATTCTTGTGTTCGTTGATAGATTCAGCAAGATGGTACATCTGGTTGCTGTACCTGAATCAATCAACGCATTGGCTTGAGACCGTGTCTTTA
TCGACACGGTCTTTCGCCTTCATGGGTTGCCTCGTGAATTCGTGTCCGACCGGGACCCGCGGTTCACAGCTGAGTTCTGGCGTTCCGTGGTCAAAACGCT
CGGAACGCGCCTTCAGTTGTCAACCTCTGACCATCCTGAAACTGATGGTTAGACCGAACGCGCAAATCGTGACCTCGAGGAGATCCTTCGAGGATACGTC
CATTCCCTTACTAATTGAAGCGAGTTCCTGCCGATGGTGGAGTTCGCCATCAACAATTCAGTCCATGCGTCGACG