Description :
From Genome Similarity Track
Location :
Scaffold_977:4830- 5878
Transcript NameFunction/comments
Phymu_g12482hypothetical protein
Phymu_g12483hypothetical protein

Sequence
1048 bases(100 bases per row)
GAGCACCGTGTCCACTAAACTAAACGGAGTGCTGATTGGCCATTGCGCACACGCGATGGCAACCATGTGACGGAGGCCCGTCATATTACACCCCACTAAA
GGTGAGAACAATGTGCTCAGTTAAAGACTTGTGAAGaaaggaagaagtcgaagacAGCGATGGGTGCTAGGCACAACGCGGACCCGGACCGGCTCACGAC
ATACGCGGAtgtgctggagcagtgggCGCTgcacgactgcagcgccgtggTGAACTCGCCGGGCGACCACGAACTGAGGGAACTGTTCCGACGTTGGAGA
GAGACGCGGAGCAAGCGTGTTACGGTGATCGGAACCGTGACTCTGCAGGCACTGGATCGCGCTTGGACCGCGTTCGTCAACCGATGGAACACCAAGGGCC
CGAGGCTTTCCAGCGGAAGATCGTGCAGCGCGAGGAGCAGCACTCGCGCCTCTCCGTACACGCGTTGGAGACCCAAATTTGCGAGCAGTCCTGGGACGCG
GATCGGGAGTGTTGCTATGTGCATTATCGCAGTGGGTGCCCAAGCTGTCGCGGTTACCATATACCGCGACCAAGTGACGCTGAGTGGGAGCACATCACCA
CTTTCACtatcccccccccctctctGAAGACGAGCTGAATCTGGTTGGCCTCTACAATCGCGCGCTGTATGAAGCTAGGCGCGACGTGGAGTCGCGCCCT
GTGGGAGGCCTGCCTCGTACACCTCCACACAGTCCGGGACATCTTCAAGGAGCACCGTACGAGGCTCCCAACTATCCGGCATTGGGCCAAGCCATTGAAC
GAGGTACTAGCGATGACTGGGGACAGCGTCGTCGCGGCGACGAGCGCCGCGACCCCGATGGCCGGGACGAGGACCAGCACGGGCATCACCGTGCTGGAGA
ATGACGTCCACAATACGGCGAATATTCCCATGGCTATCAACGAGAGGAGCGGGACCGTCGCGCTCGAATGGGAGCTCGCTCGCAGGATGCTGCGACTGCG
CAGCGTCTAGATCGGATGGCGCGTCgtctggaagtgctggagcgcgag