Description :
From Genome Similarity Track
Location :
Scaffold_86:48287- 55346
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.19Haloacid dehalogenase superfamily protein
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.9Kinesin K39
Pytve_DAOMBR484maker-pve_contig_86-snap-gene-0.45Conserved gene of unknown function

Sequence
7059 bases(100 bases per row)
AGAGCGGATGCTCCTTGGGTCGAACCCCAGCGTTCAGCAGCAGGCGCACCATGGCCTTCTCGAAGCGCTGCATCTGGATGTTCAGCACGCTCTCGCCCTC
CGTCGTAAACTGGTCCGTCCGGATCGTCAGCATGCCTGCAAAGACGGCAAGGTCGTAGGGTTTAGACCTCGGTTTGTTCATCTCACGCCGATCGAGCGAA
CGCACCGTTTAGGTTGCCGAAGAGCACGTCGGTCGAGTACCGGTCGCCGACCATGACGAGCTTGTCCGTCTCGACGTCAAAGTGTCGGCGAACATACTCG
GCCCCGCCCGGTTTCTAATACACAATCGGCACATCACAGCATGCGTCAATCTCCACACATTTGATGGGAAAGCAGTGATAATGACTCGAACCTTCTGGTT
GTGACGGAGCACGGCGACCTGCAGCCCAGTCTCGATCTCTTTCGCTTCGACGAAGTCCGGGTCGTCGTTCGATCCCGCCGAGTTGGAGAAGATGACGACG
CGGTCGCCAAACACGCGCTTGCACTCGTCGAACGCAGCCTGTTTCGTTGGTACAATAGTGGGTTATCACATGAGGAAATGACGTCTTCCAAGGCAAAAGA
GCGACCAACCTGCAGGTGAGCCGGCACCTTGTGGCTGTACGGCACTGTCAGCGTGTTGTCCTTGTCGAAGACGACGCCCTGGAAGCCCCGGTCCTTGAGC
GTCTGGAACTGCACCTCGTTCAAGTCTGCGCATCACTCGGCCAATCACTCAGCTGCCGCCACAATTATCGCACTACCAGCAGCAAAACCAGCACGCAGCG
CACTGCATAGTACTGGCTCTCACCTCGCACGGATACCTGCGGCAGCAGCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCAGAA
TTCGGTCACGCCCCGCAGGTTCAGGCCTTTCATCGCGATGATGTGCGGAGGTGTCCGCTTTGCCGGCAGCAAAAACAGCATTTCATCATATTTTCACCCA
ATCAAGTACGTCTTTAACCGAATTGATGGGCATCGATTGGCCAGAGAGATGTTATTTTCAGCGAATCCGCGGGCCGCGTCACTATATGCGGCGTAGAAAC
CGCAGTCGCAGTTCGGAGACCGGGCGAGCATCACTCTCGCGCAAGGGAAACCCGCCGTCACTGCGCGCTCTCCTCGCCCCCGCGCCGCCCTCCGTCCCTC
CCTCCGGTATGTCGCTCGACCCGCGCTTCCCCTTCCTCCCCTCGCTCTCTATGTGTCTCGGCCGGCTCCGACCGCAGGACATGTATTCTAATGGCGTTGC
GTGGTCGTGTTGTTGGCTCGGCAGCGTCTTATCCTCTCGATTAATCTACCGGCCAAGACTCGCGGAGCTCGAGGCCGGCTGGAGGTTCCTGGTGAGCAGA
GCGGAGGTTGTCTGTGGAAGATAGCGCGGTCGACGGGTTCGTTATCTCTCGAGTCGACTTAGCGAGGTTGTGAGAGCCATGAGTGACGATGAAGAAGTCA
AACGCGGCGGACTAAACGGCCAGGAGGACGCCGAGAAGGACGGCGCGAAGAACTCGAGCTCCGATGACGACGACTCATCCTCGTCCTCGAGCTCCGGGTC
GTCGTCCGACTCGTCGTCGTCCGACTCGGAGTCGGATGGCGAGGACAACGAGGAGAAGAGCAAGGAGAACGCCTCGGAGACTCCCGGCGAAGGCAACCAA
GCGTTCGGCCAGGACGGGCTGCACTACTCGGCGACGGCGGCCGCGCGGAAGCACAGCTCGGATGGGCAGAGCCACGCACACGGGTTCAGCAAGAGCGCGT
TGGCCCAAGCCACGGCTGCAGAGATGAACGTGAACTCGAACCGAGCGGCTGCGCGGTTCCGGGAGCAGAACCCGGCGCAAGCGATGGGGATGATGGCGCT
CGGCACCAAGAAGCGGGACCGCCGCACGATCGAAGAGATCCAGCGCGATCTGCAGCTCAAGCGCGGTAAGAAGCCGACGGGTTCTGGGCTGTCAGGTGCG
AACGGCGGCCTCGCTGCGCGCTCGAGTCCTCCTCCTCGCGGATCCCCAGTGCGATCGCCAGATTCCGGTGGTTCTGGTGGCGGCGACCCTGCCACGGTGA
TGGCGCAGCAATTGGGGTATGGCGGGGTGGGAGGCGCTGCTCGAAACCTCCCGAAGAAGCCCGTGTCAGCTCGCGATCGCTTGGAGATTCGGCTAAAGGG
TCGTCGAGGGAATGCGAGCGCGAATACTGCTGTCGGCAAAGGCAGGAAAGGAGTGAATGGTGGACCTTCGACGGGTTCAGCCGCAGGAACTGGAAGTGGC
GGAGGTGTTGGAGGAATGGTGACTAACATCTCTGCCGGCAAGGTCGTCAAGCCAATGGGTGGAGGTACGTCGCGTTGTCAGGACACAACAATGTCGCTTG
AGTTACTGATATCGCTATCGTGAATGTTATCTAGACTCTGCGTTCGGCGACACCCATACCGAGTTGACGTCGTCTTCGTCGGGAGGGGGAAATCTGGCGT
TGACGTCGCAGGCGCCGAGCGCACCAGCGAAGATGGAGCCGAAGATCGAGCCACGGGTCGCGGAAGTCCGTCCCGACGGGCGAGTTGTGCGCGCGCTGCT
GCGTGGGATGCTTCGGTATGGCGACTTGACGGACGTGCAGATGTTTTCGCGGACGTCCTCGTTTGCGGACGAGTACAAGCAGCCCAACTTCATCGAGAGG
TCAAACCTGCAGAGTTCGACCAAGATGACGATGGAGCGGTTGCTCAAGCTCGCGACGGATATTGCCGAGCGAGCTCAAAATGCAGTGGAGAACAAGCAGG
ATAGTATGAAGTTCTACGAAGTGGAGATCAAGCCGTCGCAAGTGATCGAGCGCCTGTACGAGAACCTGAAACTGCGAGTTGCTGTACAGCGCGCGCTGCG
CGACACCAACTGTCCGAAGAACGGCACGAATGGCGCATACGTGCTGATCGCCAAGCAGTGCGATCTTCCTATGTTGGGTATCCCTCGCGACTTCCCGCCT
TGGTCATGGGCCGAAAAAGAGCATGACTGGACCTCGCGCAAGGATGCGGCGTTGCTGTTGGGCATTTACGTTCACGGCTTTGGCGGGTGGGAAGACATTT
TGAACGACGATCTGCTGCACTTTCAGCAGCAGCGTGCGTTGAAGGGTGAGCGCATGAAGAAGCGCGCCGAGAATCTGTTGAAGCGGTTGCCGTCTCCGGA
CGAGAGTGGCGAGCCGAAGTTCGTGAATGCTGCGACGGTGCTTGCGTCGGGTCCCCAAAACCCCGGTCAGTCCCTTGGAGCGCAATTCAGCGCGATTATT
CACAACAATGGCGGCAACAAGGGGAATGGGCCAGTCGTCGTCGCCTCGGCGTCAGCTGCGAGTGGTGGTGGACGGATGCAGCGTGCCGCTGAGCGTGCAG
CCGCTCGACAGCAGGCTGGAGTCGGGAATTCGAGTGTTATCCCAGAGGATTCGATCAGGCGGATGCATCCTCAGCTGAGTAACGGCAGCCAAACCGGAAG
GTATCGCAAATCGTCGGCTGCGAGCTCGCTCAATGGCAACGATGAACCTGAGGATGGCGAGGTGGACAACGAGCGACGAGAGCGATCAGGGTCCAACTCG
CGCAGCACGAGTCGTGCAAATTCGCCAATCGATAAGTCTTCGTCGAGTGCCGCTCCCCGACGGAGCAGCAGCAGCACGAGCAGCAAGCGATCGGCCTCGT
TAGAGCTGGAGGACTCGGGCAACGAAGTCTCTCTCAAACGGCGAAAGAGCAGTGAAGGCGGATCGAGGAAGCATGGCGTGCAGTCCACCGCCTCTCGGAG
AAGGTTATTGTCAGAAGACGAGTGCTACGACAAGTGGAAACCGAACAAGAAGCTGAAGGACATTCGGCAAGTGCTGAAGAAGATGAAGATCATGACGCAG
TGGTCGAAGAACCAGAAAGATCAGGTGGTGGTGGAGAAGGTGTTCAAGTACATCACGACGATCGGAGATGCGATCGACAAGATTGTGCGGAAAGCTCGCG
TTGACGAAGGCGAGCAGAATGGTGGCCGCGCCAACAGCGACGAGCGCGACGCCGATCGCCCGAGTGATAGCCATGAGTGGGACGAGCTGTGCTCGTGCCT
TTGGACGTATGCTGCCGAGTACACGCCGTTCTCATCGCGGACGTTCGAGCAGCTCTACGACGACATTTGTGCGGATGGCGAGATGCTGCGCGCGCAACGG
CAGCCTACTCCAACGCGGTAATGAAGCTCTACCCTCATCCCCCGAATCGTCGCTGAGCTCGGCATCGCAGCGCTGCATTTGGTTCAAGACAAAAGTGCTG
GCTGCTGGTTCTAGCGCAGTTTCCGCTCGCAGCTCGCGCACATACGTTGCTCTTGTCGCTCAGCACGCACAGCCACGCAGCACAGAAGTTGCTGCATCTT
CGTCATTGTTGCTGCGCAGGATACCTAGCGATTGTCTTCTTCATGAAGGCTCAAATATAATATACCCGTTCTTGTACACCATTTTGCGAGTGAATAGCGG
GAATCGCGACTGTTTGTTGACATGGCATTTGCGGCAGGTCGACGTCAAAGGTCACGGCCGCTTCCATAGCTGGCAAACGACAGGTCGCTTCGAAACAGCG
AGCGAAAATGATGCAAATGATGCCGCCGCCAACTCCTGATGAGCTCGCGCTAAAGGATCAAGTGACCGAGACACTGGCGCAGCAGGGCGTGCTGGCCAAG
ATCAAGGTGCGCTCGCCTTGCTGACTGTCTTTGTCATCGTTCGAGTCTGAAACTCGATGGAACCTTCGGTTGTGGACAGGCGGAGCTTCGAGCGGCCGTG
TTCCGCGTCATGCATGACCGCGCGCTGCCGGAGGAGACCAGCTCCGGTCCAAAGCTCGGCGAGTTCCCAGACAAAGTCACGACGACCGCTCTCGAATTGA
TCGTGGACTGCATGTCGTTCTTCCAGTGGGATCATTCGCTGCTCGTCTTACGCGCCGAGGCTGACATCGAGTCGACGCCACTACCGGTGAAGTGTGCCGA
ATTGGCCGAGAAGCTGAACCTCAGAGCTCCAGGCGAGAATGCAGCATCAGCGATGCCCTTGCTGCTGCAGTTGGTGGAAGAACGACTAAGCAAGCAATCC
ACGCTCAAATTTGACTCGACAGCAGCTGTGACGTCGCACAAGTTGGAACCACGCGAGGAGATCAGTTCGAGTGCTGACAGATATGCTGAACCGCCCGCTC
CAGCACGGTTAGAGTCCTCGCTCACGCGTGCATTGCCCAGTGCTCAAAGTGACGAGGTGAAGCGTGAAGACGATCAAGACGAAAAGAGCGACGAGGAGAG
GTCAGTCGATAGCCAGCCTTCATTCGATCGAATCGAGATGACACCAGTGTCAGACACGAAGATGCCAGCTCCAGTCGATGACTCGGGTGATCGGTATGAG
CGCAGTCCAGTGGCTCAAGTTGTGACCACAGTCAAAGTCGACGAAAAGGTAATCGAGAGCGCTGCAAGTGAAGATAACAATGACGACGACTTCGAGGAGC
TCGAAGAAAGCATGGCCGAAGATATCGCCAGTGCTTCCGAGCTGGACGAGTCCGGCTACTCGAGTCCAGAGCCTCAGCTGACGCGAACACAGGCCAAAGA
TGAAGATGATCGAACCGAGGAGGCGGCATTCAGTGCTCCAGTCCAACCAACTGCAACGCAGGCGCCGCAGCAACACCACGACGATAACGACGACGACATG
GCTGAGCATAGTGCGAGCGCTGAGGACGCAGAGCCGTTGGCGCCTCCACCGGTCCCGACGCGATTGACCTCGCCGAAATCAATGGACGCACCTACGACCC
AAAAGAGAAAGGATCAGCATGATGATCTCAACGAAGATGACTTTGACCCGGTGAGTACAATGGTCGACAGGTTGTTGCCGCATTGATATCTAACGGATTT
GAACGAGTAGGATCTCGAGGCGGAGCGCTTGAGTTCGTTAGACGCCAAGCTCAAGGCGATGGAGGCCGAGGACGACACGGGCACGCTGCAGCAGCTCAAG
GCATCGCTTCAGATGGAGCTGCAGCATGCCGAAAGCAGCATGCGCAGCGACAAGTCGGGTCGCAGCAGCGAGCAAGGCGGCGGCGACGACGACGACGGGT
ATGGCAGCAGCGACTTTGAGGAGGAAGAGGAGATCGCCAGGTACCGCACTGCAGTGGACAGTCCACACATCATCTCGCAGATTGTAGACTGATGGCATGT
TCGTGCAGTGACATTTCCGAACAGGTCGAGTCGATGGCAGAGGAATCGATGGCCGCAGAGTCCGAGCAGGCGGAGGACGATCGCAGTGACGTGAATGGTG
GCAAGGAAGCCATCACGGCAGCCGTGCCTGCAGTTCTCCAGGACGATCGAGCTGTCGAGAGCGAAGACGCGCTGAATGGGTATGACTACATTGAAGACGT
GGAGCGAGGGTGGTAACATCGCCCCCAAGCTTGATGTTTTTGAGCGATCATGCAAGGTCTAGTCCTCCTCGTCCTCGTCCTCCACGGGCTTCGCCGGCGG
CTTGTAGTCGCTCCCCATGAACTTCTTGAGCAGCTCGAGGTCGTCGAAGCACTCGGGGTGGATGAAGTAGTTGCTGCCGCGCGCCTGGAAGGACAGCATC
GGGTGCATGCCCGGCTCGGGCCGCGCGACGTCCGAGATGAGGAACGAGCTTCGCTTGAGCTGCGCGAGCAGCGTGAGCGTCTCGACCGTCACCTCGATGT
CCCCGTCGGCCTGCGGCGGCGCGAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGTACGGCTTGAAAAGCACGTGGAAGAGCGACGTGGTGCCCA
CGCCGAAGAGCATGATGGTGCCGCACATGGCCCACTACAGATCGACAGCACAGCGTCAGTCTCCATGATTGTGTGTAGCCCTAATCTGTACAGATGTGTG
GAGCCAAGCACACTCGTGCATCCTTACCTTGCCGATCATGGACGCCGACTGCTCACTGAGCACCGTGATCATCGGCATACCCACCGACGTGAGCACACAC
GAGGTGACCGACACGCCCTTCATCATCCGCACCGAACGCGCGAGCGGCGCCTCGTACGC