Description :
From Genome Similarity Track
Location :
Scaffold_9:482766- 484637
Transcript NameFunction/comments
g5618.t1POM59582.1 Calcineurin-like phosphoesterase [Phytophthora palmivora var. palmivora
g5619.t1KUF80452.1 hypothetical protein AM587_10017546 [Phytophthora nicotianae

Sequence
1871 bases(100 bases per row)
GCGCCCACGTGTGGCTCAACGGCCACACGCACGGCTTCAACCACGACATCAGCAACTGGGGCACCCACTTCTACGAGAACGGAGGCGGCGGCGGTATCCA
GAGTGAGACGTCGGGCATGCCTCCTGAGGTTGCTGAGAAGTACGTGGAGCACGCGTGGATTGCCGCGGGCAACCCGTACGGCTTCTTTATGCTGCACTTC
TCCGAGGACTGGCTCAAGACGGAATTTGTGACGTTCGACGATTCGTGGACTTTCAGCGTCAAGAAGGACGAGATCGTCAAGGGCGGCTACCAGAAGGGCC
ACTGCTGGCACGTTCCGGTCACCATCGGCACGGGTAAGGAGTGCGCCACGAGCCAGAACAGAGTGTAGACCCACCGACACGAGACACACTGCCAGTGTAT
GTAGACATTGTGGTTAGCGACATAGTCTTCGCTTCTGTTTTACCCGATAATACATCTATCAAAACTCAGTTTTGGAATTGGTCTGCTACGATAAATACTT
GTCAATACTCAGGATCTCAAGGCTTCACATCGCCCAGTCTTCCTGTGCCAAACGTTATTCGCCTGCACCGGCAGGTGTATTGGGAGATTCTATCATCTGA
AAGCGTTCTTGGTTAGACGCCAGCCCTGGATTCGACTGGGTTTCCCCAGCGGGCGAGCCTGCGCTGTTTGCCGGGCGTTGTTGTCGCTGGTAACATTGGG
CTTTGTCCAGATCTGCATGTACTTCGTGATGAGGCGGCAGGTTGGTAGTTTTCGATGTACTGCAACGTTCGACCGGCCCACAAGGAGTTTGCTTGGGAGC
TAGCAGCTGATCAAAGCCCCCTCGCTCGTCTACTTGGTACCCGTTCGTGTTGCGAGTTCCATTTGTCGGTTTGTTTTCCCCGTCCTCGTTAACCTCTCCG
TTTCCTGGCTGCACTTGTCTTCGATGGTTTGGTGGTGAGTGCGTCTGCTGCAGGTGCTCGCTGTTCCTCTGCTGGTCTTCGTCATGCTGACGACTACCCT
GTGTCTTCTCCAACTTTAACTCATCGACCTCCCTCTCCAATCCCTCAACCTGCTGCTCCAGGTCTTCCACCTGGTGACGCAGTGATTCATTATCCGCAGT
CGTCTTGGCAACGAACTCCTCTGCCTCTGCACGCAGCGCCGCCCGCTCTTCCTCAAGCCGACTTGTCAGCTGTATCTCCATGTTGGCCACATACTGTTTG
GCTTCTTGCACTATACTCCCATGCACGCGTCCAAACTCGGCGATTCTCTTTAGTTGTTCATCTGTTCACCAAAAAGCATTTACCAGTGTCAGCAGCGTCT
AATAAACTAGCAACTGCAGTCTCCTGCATACTCGTAAAGTGATCTTCAACGTGGAAAATCACTCTCTGCTGCCACTTCTCGAGCTCCGACACGGGGATCG
TCACTACCTCCTCCTCTTCCGCCTCCTCTTCTTCGCTGGAATCCGCTTCCCTCCGTCGACTGATCGCGTCATCATCTCCGCTATTTCGTCGACTCTTGCG
GCCTCTGGGAGCCTCTCCACCAATGGGAAGCGTTGTATGCAGGCCCCGGAACGGAGGACTCGGCAGTTGGAAGCTGTCCGAGGACTCCGTGTCCATCGGA
TCCTGTTTATTGGCCGCCAACCCCCGCAGCGAGGACCGAGACACGTCGTCAAGAAGACTGGAGGCCTCTGACGCAGACGACGACGAGCTGTTGGCTGCTG
GGTCCACGTAGCGCCGGCCGATGCGCTTCCGCGTGACTGGCGACTTCTTCCGGCCCATTTGTCTACTGCACTGGATTGGAAATGATTGTCCGGATGGAAG
GGGATTGGTGGAAAATGGGATCTACATTTGTAGGTTGATATAGGATCCGACCTACACTTGGCGGAGCTTCT