Description :
From Genome Similarity Track
Location :
Scaffold_805:4827- 9828
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_805-fgenesh-gene-0.1Histidine acid phosphatase
Pytiw_DAOMBR242034maker-piw_contig_805-snap-gene-0.11CG15877 CG15877-PA

Sequence
5001 bases(100 bases per row)
GTGAACTCCTCGCGCTCGCTCTCAAAGTCTTCGCCATCGTTGTCGTCATCTTCGCTGCTGCTGTCTTCCTGCAGTGTGAGCTCGTGAATTGTCAGCGCCT
GGTCCTGGATCTTCCGATTGAGCTTCGCTCGCTCGATCTGGGTCGCCTTGATCTCCTGTAGCAATTCGGTTGTCCTCCGCTCATGCTCGGCGCGCCAGGC
TTCTTGTTCTTGTCGGAATTTCTCTCTCAGTGCGCACAGCTCACCTCGTAGAGACTCGCACTCATGCTTTAGAACGAACACGGTGTTGCCGTCCGCACCG
TTATCTAGATGCACGAGCTTTCGGTTGTTGAGCTCGCCTGAATTGGAAAATGCTGAGGAGACTGGCGATCCTTGAGAGGAAGTTAGGGGACCTTGCACTT
TCGCCTTCGATGGCGAAATGTACACCGCTTGCGTCTTGGTCTTGAGCAGATCATCGATGGTATGCGCCTGCTCCTGTCGATTTCCATGAATATTGATCAT
CAAAAGTAAGTATTCATACACATAGTACAATGGTACAGCAGTATGCTCACCTCGATCAGTAGGTTTGCACTGAGCTGAGCCTCGACGATTTCGTTCCAGT
GTTTCGCTTTCTCTCGCTGTAGAATGTCGCACTGGGCGAGGTCCCGCTCATGTTGCTGCACCAGTTCTTCTCGCTCATGCAGGAAATTGGCCTTCTCCGC
TTCAAGATCCGCTACTAACTGGGCCATTCGCTCGGTCTGAATGGTAGCAAGCGAATTTCAGAACAGTAAGCATACACAGACGACAGCATAGTAACATGTA
CACTCAGTTTAGCTGCCAGTACCTCTTCTCGCCGACTCGCCTCCAGATCCTGAAGTTGCTTGTTCTGATTTCCAGTCTACAAAATATTCACGGCGGTTAA
GGACTCGTACAGTCAACACTTTCCAACACGAATCCCATCACACAAGCGAGACTCACCACGGCCGTGAGACTTGTCAGGTTCTCCATCAGCTCCTGCATGG
TCTTCTTGTTCATCTCAAGGTTCTGGGCATCGTCCTCGCGCTTCTTCTCCAGCTCTTGCACTTTCTTCTCCGCGCGCTCGAGCAGGTCGACGGATTTCTT
CTCCTTCATTTGCAACTCGTCCAGGTCGCAGCTGGTATCGTGTGCTTCCGTCTGCATCTTGTCTTTCTCCTTCATGCACTGCTGGTACTGCTTGTAGATG
TCCATGTACTTGCCATTCAGGTCCTGGAACCGATCCCACCGTTCCAACTCCATTTCTTTTGCGACGGCGAGCCGAGTCGCTTCTTTCACTACATCCATTT
TCCGCGCCTCATCCTCCTGCTTCATCTCGGGCGTCTTCAAACACGCAGTACACGTCGCGCTGATCCGTTTCTGCTTCTTCTCGAGCTCCCAGAATTCCTC
GTCTTTGACTTTCATGGCTTGCTCGTGGCGCGCTTTCATTTGCCTCAGACTTTGGTACATGCGCTCATTCTGCTCCGAGAGCAGTGTCCGCGTCCGAAAG
AGTCCTTGATAATCCTCCTGAAGCATCATGAGCTGCTCTTTCGTGTGATGATGGTTCTGGAGCACGTCGCGCCACTTCTCCTTCATATTCTTGACGAGCA
TTGAGTGCTCGACTTTTTGCTCGCCCCGTCCTTTCAGCGCCTCCTGTAAAGCAGTCGACAGGTCCGCGACCTTGCGTTTGTACTGCATCATCTCGCTGTT
CATCTTCTCCTTAAGCTGGAAGCTCGAGTGCTCGCGGTACCTGCTCTCGCCCAGCTCTTTCTCGAGCAGTTGCAGACGCACGCGGCTTTTCTCAAGCTCC
TCACCCATGGGTCGCTTGACACTCTGCCACTCCTTGCGCTCGGCCTCGAGCTTGCAGCGCAGCTGGTCGACGCGCGCGCGCAGCGCCTTGCGCTCTTCGT
GGGTCGTGCTCACGTTCGCCGCCGCCTCCTTCTTCACAAGCGCGATGGTCTCGTCCTGCTTCTTCTCGATCGTGCGCACTCTCTCTGTGAGCTGCGCGAT
CTTGTCCTGGTCTTCCTGGTGCTGGTCGAGCGCAGTCTCCAAGAGCGCGCTCGTCTGCGCGAACTGCTGCTGGTACTTGACGCTCTCCTTCTCGGCGTTC
GCGAGCGCGTGCTGCAGAGACGCGATCTCTTTCTTGAGCTGCACTGTATGCGCGCTCGCGACCACCGCGGCCTTGCTCGCGCTCTGCTCCTTCTTCACGA
GCTGCTGCCGCAGCGTCTCGAGGTCCCGCAGGAAAGCGCGTCGCTCCTGAGTAGAGAGACCACCACAAGACGCATTAGTGAGCCATACAGTGGCAACGCA
TGGTAACTAGAACAGTGAATATGATACCTTCTCAAAGCAGCGCTGGACGTCCTTCATGGAGAGCGTGGTGTTCATCGTGTCCTTGAGCGTCGCTCCGACG
GTGTCCATGCGCTGCTGCTGCATGGTGCTGTGCGCATGCAAATCAGCCAGGACCCACAAACAGACTCACACAGCGCCGAGCCGCTCTCGAGTGGAAGTAG
AGAGGCGTGCTCAGCACCAGCACAGCCACCGTCGCACGCTTTAATGCGCGGCGCCTCCATGCGAGTTGTCCGCATTTAGCGCGGGGTTTCCCCTTTGAAA
ATTTATATCAGAGTGCATATTGATTCATCCAAACCAAGACTTAGTACAGTAAATCAACTCTACAAATAAATACCCTTGCCAAATCGATAGTTGAAGTCGC
CAACTGGGAGGTGGTTTCGAAACGGCGCTCGATGCCCTCTGGCTGCTATTCTCATCGAGATGGCTCCAGAAGGTTGTGCTCACAATGGCGAACCGACATG
CGATACGTTGAACAGTACCAAAGGGCTGGACCATGGCTGTGTCTCGCCCCATTACGTCATGGAACCAAGCAAGGGCTGGAGGTCATCACTGATCTAGTCG
TCCCACTTCTACACACACTCCTTAATCTAATTGAGCATGTGTCCGAGGAGCTCCTAAAAATCATAGATCAGCAAGAATGTCGCCACCGCTGCGACTGCGC
CAGCTGCAAGTGCTGCACCGCCATGGAGACCGCACGCCGCTGCGCAACGTGTTCAAGGGAACTGCGCTCGCCGAGCTGGAGGAGTGCAAGCGCTGGACGC
CCAAACTGCCGCTGTCCGAGCAGCTCATGCAGCTCGGCAGCACGTACCGCGTGAAGAAGGTCGAAGGCGCCCACGACCCGTTCCAGACGCGGCCGTTCGG
ATATCTTACGACGACAGGCATCAAACAGATGACTGCGCGTGGCGACAGTTTGGTACGCTGCATGTATGCGTGCATTTATGTGTTCATGCTTTGATATGTT
CCAACACGTTGACTTGTTTTTTTCATTAGCGCACATTCTGTGAGAGCGAGGCGTTCCCGTTTGGCTTGCTGGTTGGCAACGACATACAGATCTTCAGCAA
CTCGTACACGCGCACGCAGCTGAGCGTGCAGGCGCTGCTACGTGGCTTGCTGCGCGACAAGCCCCTCGTAACGCCGCAAGTCCAAGTGCTGGCACCGGAC
AGAGACATTATCAACAGTAAGTCGCCAAGCGAGTCAATCCACTTTAGCTGACCAGACTGACGCGTTACTTGACATCTGTTACTGCACAGCGTACGCGTCG
TTCCCAGAGATCGCGATGCTGCAGACAAATCTCGAATCCGAGAGCGAAGAGCTCAAGTTCCGAGAGAACGAGATGGAGCCCCGCAAACGAGAGATGATGC
GTATGCTGCCGGTTTTCGCTGACGCGAGCGCTGCTGCGGCGCCGTTCACATGGATGGCGGTCGCCGACTACTTTGTATGCCGCGATGCGCATGATATCGC
GTTCATCCCTGGGACCGAAGAGCATTTCCAGGCGTCCGTGGACCACTTGAGCTTCCGCTTCCACCAGTTTTACTCGCATCCGCGCATTTTACAGCTCGTC
GCTGGGAGACTGATGCAGAACATGCTCGTGGAGGTACGAACCAGTGTCCTGATACCCTATCGTCGCTGGCTCGAGTACTCACTCGTCCTTGTCTTGCTGA
ACAGATTCAGAAGGTCATGCGTAACGAAATCGACCAAAAGAAGCTGATCGTCTACAGCGGCCACGACATTTCGATCCTCTCGGTGCTGCACGCGATTAAC
GCGACCCTCGCAAACGACGAGAAGTGGTGGCCAGACTACTCATCCGCAGTCTCGCTCGAGCTCCTGCAAGACGAAAGCAGTGGGGAATGGTTCGTGCGCA
CGCGTCTGGACGACAAAATCCTTGCGCTGAGACGCAGCAGCGATGCCAGCATGTACCAGTTCGACGAGTTCCGCGCGCTGATCATGGACAAGATGAGCGG
CTTTGAAGAATGAGCAGCTCATTGGAGTGAGGGAAGAGATAGAATGACAGAGATCAGAGAAGCTCGGACGACGAAGACTGGATGAGAAGCTGAGTAAAGA
TAAACACACGATCAAGTTACTACTGCCAAGCACTCCAGCGAGCCGGGCACTTGCTGCTTCTTTCTATTATGCGAGACGTTCGGCGACCTGAAGAGCACGC
TTGTATCGTCGTCGCGCGAGTCTCGTGGGCAGATCTTCTTCGTCTTCCTCGGTCTCGCCTGACTTTCCAGGCACACCAGCGTCGATGATCTCGTGGGCAC
CATCAAGCACGCGCTACACACACACAAATCACACGTGTGAGTCTCCAATATCACATGATAACGAAGGACGAGTACGCGTACCTGTCGCGCCTGGCCTTCA
ATGCCATTCAGGTAGTCGAGCACGATCGTGAAGAGGGACTTGGGCACCACGTCGGCCTCGTACATCCACCGGAGAATCCACATTTGTTTCATTTTCTACA
AAGCCAATCAAACAGTTAGCGCACCAGGTAACAATCGCAACGAAGCACACGCAAGCTCATCGTACCTTGAACTTCCACGGCAGTTCCCCCTCTGGCACAG
GCTCGTTCCTGGTCTTCCACTGCTCCAGGTAGTACTTGGCCTGCTGGATCATCTCGGGCGACCGGTCCGACTTGCCGCCGCCCTCTTTCTTCGCCTCTGC
A