Description :
From Genome Similarity Track
Location :
Scaffold_730:4826- 6301
Sequence
1475 bases(100 bases per row)
ACTCAGTCATGTAGACGTTCTCCCCGATTCCCACACATTCTTGCTTCTGGCTTTCGTTGATCATACACCCCACCTTACGAGCAAAAGTAGCGTCGACGAT
TGAGACCTCGGCTCCAGAATCGAATTTCATAGTGGCCCTTTCGCTGTTAATTTTACCCACCGCTTTAGCTTGTTTAAGCACTTTCCCGGTATGTAATACT
TCCAATATTCTCGCGACTCTCCCGGCGCTTGATCGAGCTCCATCTTAACGGGAGATCGCGACTATTCATCCACCCTCTTCACACTTGAAACACTACGCAA
ACGATGGGTATCCAAATCACATGTATTAACTATCGGGTCGATCCGATTGTTACTCCCCTGATCGATTATAAACATCTCCTCAAATGCATATATGTATAAC
CTTGAATGCTCGGATCGTACCAGATTCCAACCTGGCGAGCGTCCTAGTTTAACATCCCCTCCACCTTGGTCGGGAGGATCCCCGCGTGCTTGGTCGGCAT
GTACCACTTACGGATCAGGTTATAGTACTCCATGGAGAATTGACCGCTATCATGAACCTCCCCACACGCGGGACACGAATGTAGGCATTTATCCGAGGGA
TGTCCTTTGCGGCCACACTTTTGACAGGTCCATCGTTTCCAACATCCGCGATCATCATGTCTTTTTGAGCCGCAGTGTGTGCAGGCTTTCGACAGTCCGA
CGCAATCGCGATCATCGTCCGATCTGTCTTTCGCGATCTGTCTCGTTTCTCTCCCAGATCTGCGACTTGATCGGAGGCGGTCGTCACACCGATCTTTGCG
CCGAAACGCTTCTTAAAATATTTATTGATTTACGAAAATTTATTTATCTTCATCCGATCCATCCGAGCTTGAGTCCAAGTCACTCTCTTCACTTTCTACG
CGAATGGCTTTCAATGCGCGGGTTGTTTTTGAATACACCGGAGCCGACGCTTTAGCCGATCGCAATCGAAATTTGTTTGATTCGGCCGACTCTTTATTCT
ATCAAAAGTCCATACACTGATACGCGTGTAAAGCTTCTTCCGTCTGATAGCGTCATGTCTCGCAATATTGTCGGATGTTTCGCCAGCTCTCGCTCGTCCA
AAGTATCAATGAAATGCTTCACATGCTCACGTCGGCATGGTGGCGGATCATCTCTGAACGACACTTTAGCTCGCATTCCTGCCACATTCAGCAGGTGGAG
ATATTCCAACGGGGTCTCATTCGATCGCTTCCACGCATGGTAATATTGCCTTCCTGCTGACATTCCGTATCATCCGTATTGGACCATGAAACTTTCTGCC
AATGGTTTCCACTCATTACGGGTCGATTGGCTCAACTGGTTGTACCATGTACCAATTTCGCGCAGGTCCTGTCAGCAGACCTCCAAATACCAAATATTTT
CCTTATCGGGAGCTTGATCACGTAGATGGCTGTCTTCATCTTGATAATCCTGCTCCTGGAAACGTTTTTCGGCTG