Description :
From Genome Similarity Track
Location :
Scaffold_115:48255- 53428
Transcript NameFunction/comments
Phypl_g3470hypothetical protein PHYSODRAFT_397963
Phypl_g3471hypothetical protein PHYSODRAFT_313159

Sequence
5173 bases(100 bases per row)
ACTTCGGCGGGAAGTACACCCCCGTTCGAGTTGAGTGGATCGAAATTATTATCCTGCAGCTCCCTGGGAATGTGCGAAGAAACCAGTTAGCGCAACCAGC
ATGACAATGTTGTACTTCTACTCGAAGTACGCTTCAAGGCTAGCACTACTTACAGAAACTCCAGCTTTGTCAGTTTTGCCAGTGACGCGGGAATTGCGCC
CACAAAGTGGTTACGGTCGAGACGCAGTGTACGCAGCCCGATGAGCCGCGACAACGTTTCAGGCACGTAGCCTGTCAAGAAGTTGGAGCTGAGGTCTCTG
CACGCACGAATCCCCTCAGTTAGTTATCAGGCTTATGCGTGGTGGGGAAACGCAGCGAAACCCACAGCTCTTGGAGACCACTGAGATCTCTCCGAGGGAA
CTCTGGCGGCAGGACCCCCACGAGATTGTTGTTCGCCAGGCggctgcaacagcaaagGGCAGTAAGTCTCGTGCCGTTCTGTAGCAGACTTCGTTCCCCC
CATTAGAACTCGATTTCACTCACATGGACCAGATGCGGCCGTTGCGGTCACACACGATGCCGTACCactacagcagcacaagaacGCCCTAAGAATGAAA
ACGAAAGCCGCACACACACAGACACGCTCGTTCACGCACGTTGTCCAGACACGggtcgctgcgctcgttcTGAATGTCCCATTGCGCCGCCCAGCGCTGG
CCATGCGTGGCCCAATACAGCAGCTTTagcgcgccgcgctcgtTCCGCGTGAtcgccagcgtctcgcccgcccacgacagcagcaaccagaCGACCGCAA
CGGCACAGCTCTGCATAGCAGTAAGTTGCACCTGTAGCCATCACCTTGACACATGGCTACAATTAGACTCGCACTTCCCTTGGTCATACGGTATGCGATA
ATAAAGGTCAAGTCCAAACCCgcatcgtcgccatcaacgagaagcgcgcgcCGACATGCTACTGGAGAAGCCCGAGGACGTCAAGCACGAGAACGCGTCC
GGGACTGGTGCGTGTGATCTACGTAGCCAAGACGCCAGGCTAACGGATGCCGTGCTCGAGGCTCTCTCACTCGCTCTGGTTGTCGAGTTCTGACCCGCTG
AAACCTGGCGACTGTGGTGCTCCGCAGTGTGCGCCATCTacggcgtggacgcgcacccgacgctgcagctgtttGCGACAGCAGGCGGCGACAACGCGGT
CAAGATCTGgtcgctgcagacgccggAGGAGGGGGGCATCGCctcgttcgagctgctggccacgctggcgAACCACCAGCAGGCCGTCAACTGCGTGCGC
TGGGCGGGCCACGGCCGCTACTTGGCCTCGGGCTCGGACGAccagctggtgctgctgtacgagtTGCAGGCGGGCGCGCCGGCCCCCGTCCCCTTCGGCT
CCAACGCGCGACCCAACAAGCAGAACTGGGTGCGCTGCTCCGCGCTCGAGAGACACACGATGGGTGAGCCGTCGAGGCTGGTGGGCTGAGTGGATAAATA
CGCATGGGGCTGATGCTGGCGGTGGTTGTTTCTACAATATTTGTAGATGTGGCGGACGTGGCCTGGTCGCCGGACGATCGCATGCTGGCGACTTGCAGCA
TCGACAACACCATTCTCATCTGGGATGTGGGCGTGGGCGCAGTGAGTGAGACCATGAgccagccgctgcagacGCTTACGGGCCACAATGGATGGGTCAA
GGGCGTTGCGTGGGATCCTGTTGGCAAGGTGTGCTAATGCGTGGATTGACGAGTGTAGATGTGGTGTGGAGCTCACGAACGCTTGCTGCCTTGTGCTGAA
GTATCTCTCGAGTGCGGGAGAGGACAAGACAGTGCGGATGTGGAAAGTAGCTGACTGGCAGGAATCCGACGTCGTGACGGAGCCATTCGAGGGTTGTGCT
TCCACATCGCACTTCCGCCGGCTTTCATGGTCTCCTGACGGATCGGTCCTCTGTGCCACACACGCTTTCAGTTCCAAGAAAAACATCGCTGCACTACTGA
ATCGCGGGTCCTGGACAAATGATCTCAAATTTGTCGGTCACCAGGGCGTTGTGACCAGTGCGCGATTTAACCCGAAATTGCTTGGTACGTCGATCAAGCG
GCACGGGGATATCAGAGTATCGATCGTGGTGATGATGTTGCTTTTGGTTTTGCTATGCAGTGACAAAGGCAGATCCGGATAAGGAGTTTGCATGTTGTGC
TGTGGGCGGTGAAGACGCGACTGTAAGCATCTGGCTGGCACATCTCGCTCGCCCATTGGCAGTCATCAAGGATTGCTTTGACTCGTCAGTCACGGACCTG
ACTTGGTCTAGCTCCCAGTCCCTCCTCCTTGGCTGTTCGCTCGATGGTTCCATCTGCTGCTTTCAGTTCGCAGGCGACGAGATTGGTACCCCGATCTCTG
CTGCGCAGCAGAGTAAGCTCCTTCAGGCAAAGGTATGTTCCTCAGTATTTGCATGTTATAGCATGTGGGGTCTAACACTCCCTTCTTGATTCTTTGTTTG
ACATAAAGTATGGATCCCGAGCCGGCATTACGCTTGCATCAACTCTGGTGGAAAATCCAATTCAACTTCAGGTACGTCCAAGCAGTGCCAGTTGGTGTGG
GACGAGGTAGTTACCGAAATGAATATGCTTTGCTGTGTCTAGCTTGAAGAAAAGTCGACGACCTCGCCACTGTTGACTGTCAATCGGAATTCTGGGacca
gcgcagcgccgaTCGTGACGCACACAACAAACACACTCATTccaaagaagaagaagcttgGCACACAGGCATCCAGTACACTGCCACCAAGCGGAGCAAC
TCAAAACGACAAAAAGCGGATCGCCCCAGTGCTACTTCAAACTGACGAGCAGTCTTCAGCCAACAATCCAGCTTCATCGCAGAACAATATTCGCAATATC
TTGGGCCCGACGATCGTGTCACCGACAGCGTCGGACGTTACACTCTTGGATGCTCGCATGGCATCAACAAGTGGAAAGGAGGTTAGTGTTGTCCCTGACA
CTAACAATTCTGCAACGCTCCAACCGAGCTCCGCGCCGAGTCATAGCGAGAAGACTGGGCCCGCCTCCAAGGAGAAGCATTCTCCGGCGACGACAAACGG
CGCACCGTCTAAGCCGTTAAAGCCGGAAGTGAAAAAGAATGGAGTTGATGGGACTTCTTTGAAGAGAAAGCGAGAAACTGAGCGCACCCCAACCCAACCC
GCCACAGTGGTTGCGAAGTCGAGGGAAGTTGGCGTGCGGCCACCGAAGCTACTGAATGAAAGGTTTGTTGAATGCCGTGTAGTATTTGAAGTGGTACAGC
TACTAACTCGCGATGCATTATGCCTTGCAGTAGTGCTGGCGTGGCCAGCGGAGGTCAGTTGTTACCTGAATTCCCATTCAGACTGCAGTTCTCCGTAGAA
ATCGATACGAGCACACAAGCTAGCACTGCAAATGCCAGCTCGAATGGCAGAGCAAGAAGTGTCGTGGCGTCTTCTAAAGCGGTGATGGAAGTTATTGTTC
ACAACCTGAAGAATCCTCAGCCACAAGAAATCATTGGTGAGTTGCGAGTACTTGCTTGCCGTACATGAACGATCACTGATGCTTTTGATCCATTTGCTAA
ACAGAGTTAGGTCCAGTTTATTCAACTATTAAATGCTCCGAGGGAAGCGAGGTCAAGTGGATTGACCGCATTTCTGGCCGAGTAGTGTGCGCAGTCGGAA
ATGCGAGCTATTGTGCAGTTGGTGTACACAACGGCAACCTTCTTATTCTCAACAGCAGCGGACGACGACTGTTTCCGTACATTGGTGGGTATGCCAGTTA
TTACTTGTGGTTGCTCAGAAACTGACGCTCGCCGCGTTGATGATTACCAGCTTTGGGCAGTGCCATCTCAGTAATGGAGTGCAGTTTGAGCGAGTCGTCG
TATCTCCTTGTGATCCTGGCGACAGGCGACCTGAAAATATGGGATCTAGCCGAGCGTAAACTCGTGCTCTCTAGCTCAATCGAGGCGATTACGAGTGTGA
GTTTGACCCTGAAATGTCTGGGGCATGGCGCTTTGATTCTGAATTTCCATTGTGTATTGTGTCGTGTAGATTACCCCAGCAGACCATCGGAAGTTGACGC
TTCTCCGGTGCCAGGTGACGACAAAGGGATTGCCGCTTATTACGTTTGCCGAGTCCAACTCCGAAACGAAAAGCAGCTCTAGCTTGCTCTCCTACACATT
CGACACTGCAATGGCATCATGGTACGGACTTGGTAGAATGGAAATTATATCATGTACGTGGAAGTTGATGTTGTTATTCACGTACTTCGATCATGTGTAG
GATGCGAGTGGCGGACGACAGCTTCGTGTTCTCGGACTTTGCGTCTGCTCTCCCGACGGATGCAGTCACGGTGAAAAGCGTCCCTGTACGTGCACACGTT
CTTGTTTGTGCTAGCTGGCCAGGTGTTCTGATAACTACGGCTTTACATTGCGTTCTACAGATCGGACCACTACGGCGGCTCCAAAATGCATCCGGCTATG
GCCGGACTCAAAGGGGAATCGCGTCGGCAATGCTTTCGGGGATGTCAGATCCGCTGATGCAGCGCAACGTGACGCGCTCGCACCTCGAGCATCAAGTCGC
CGCTGCGGTCGTCCTGAAAAGTTCCGCCGAGTATCGCTATTGGTACTCCCGCGCTCTGCAAACGTGGCCAAAACCTTAGTGCTTATGATTTCTGAAATGC
GTGATTTACCACAGGATTCAGGCGTACGCGAGGTTCCTGACGCATGACGAGGACGTGCCTCGCCTGGACAACCTGTGCGCTGAAATGATGGGCCCCTTCC
ACGCGTACGTTTCTGTTGATCTGCTACCGTGGTTGCTGTATGTTAAACTAAGCGCCATGCGTTCCGTCCTGCAGACCGTCATCCCCAAGCGATTGCAAGA
ACTCCAATTTGGATGAAGGTGGCGAGTGGGATCCGATGGTCTTGGTACGTCTGGCCTCTGCATGTCGTTTCGTTAGCAATGGCCAAGTCGCCATTGTGCC
CCCACAACTGGCCCCTGACTTGGATTGATGATAGGACCTCGTGAAACGGGACATGTTGAAGACCCACATCCTGCCTACGATCGCGGTGAATCGCGCGTTG
CAGCGTGTGGTGGCCAAATACCAGCTCATGCTGAGCGAGGTTGAAGCCcgcgagaaggacgagaacgagtcTT