Description :
From Genome Similarity Track
Location :
Scaffold_242:4825- 6246
Sequence
1421 bases(100 bases per row)
CGGCCGAGTCTTCTGGCGCGCGTGCGCTATACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCTCAAACAACCATCTGTAAATCGCGCTTCGAATTC
GCTCTTAAGATAGCTACGTACTCTGAATTCAAGCGAATCATCTTGTCGGTAGCAAAGTAGCTATGGCTTAGGAATATGGTACTCAATTTGAAGTGTCTTC
CTCTTGTGAAGTAATGAGAGAAGATGTTCTTCTGGAGCAGCTTATCGTTGCTGTAATCATCGATTATAACAAGCTCAGGCTTGTTAGAACTCATGGGAGT
ATGACGCACTTGATCTACTCTGGGTGGGGTATCAGGATCAGCAAAAGTGATGAAATCCTCTAACTTATCACGTAGATATTCGTATAACTCTTGGTGTGGA
TTGCGAGCTATGATCGTCAAATGAGCAAACACGTGGGGAGAATGCTTGAGAATGAACATGCATAGATTGTTCTTACCACTGAACGAGGGTCCAAGGACAA
CCATTCTAAACAGCTTTTTAATGTCAAGAGCAGGTATATCACCCATACCAGCAGACTTGAACTTTTTTGGCAACGAAGCGCCGAAGTCTGGAATACCGCT
CATGATCGTGTCTTTAATCACTCGATCTATATAGCTCGAGACAAAAACAACTATGAGTTCAGGTTTCTCTTGTCCCCAACCAATATTTTCGTCGCCTATC
TATAATCCTTCTTTCTATCTAACGTTGGATACCAGTGGATATCTAACCTATGATTATGCGCAGACGCTTTACCTCGATAAGAATGATTATCGCTTGACGT
ATATAACAGGACTTACTCCAGGAACAGCAACGCAAGGTGTAGCCCTCGTTCCAGGTACTAACAATGATATTAGTGGGATTGGGGCATTATCATGTACCAG
TTTGACTGTGAATGGTTCCAGCGTATCATCTCCTCCCACTTACGTAGTCGGTATCGCGCCTGGTACAGCAGCAAACAACAAGGCACTCGTTCTGGGAGCC
AGTGGTGAGATTGCCACTATTAGCTCACTGACTGCAACGTCAATTACTGGCACGCTTCAAACAGCGGCACAAACGAACATAACCTCAGTAGGTACTCTAT
CGTCTTTGACGGTATCTGGTTCGATCACTGGTACACTTGCTACTGCTGCACAAACCAATATTACCAGCGTTGGTACGCTGACTAATCTCACGCTCTCGAC
CGCAGGAACTGGTCTTCAAATACCAAATCTGAAATTTTGGAATTCAACAACCTCTCTGTATGACAATTTCAATCATAGCTACTACGTCGGAGTATCTCTT
GGCGGCGCCGTGGCTTCCAAGGCGCTCATTGTCGATGCAAACAAAGATATCAGTTCTATTCGTAATCTAAATGCTGCGAGCTTGAATGGATCAACACAGG
TGAGTGGCACTCTCGGCGACT