Description :
From Genome Similarity Track
Location :
Scaffold_576:4824- 8959
Sequence
4135 bases(100 bases per row)
AGAATCCGTAGCGACGTTGGACGAAACGTACATCTCGGTTGCTCGAGTGTTAACGACCGAAGGAAATGAAGCAACGGAGGGTACGAGAAATGATTTCTAC
GAACACCCAGTTAACAACATTGGCTTGGAAGACTACGCGAAGGAGCAGGCACTCCTGCCGGACCTGACCGAAGAGATCAACACGACTATATACTACAATG
CGCTCAATGTTGCTGACCCTCAGCTGTTGACATATCGCCGAGAACGTCTGGTCGCAACGCTAAAGAACCACGAGCACATCCTGATTGCTAGTGGTAACGC
ACTACCGCCGCCAGCCTACGGTGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTACGATTTCTCGGC
AAGCTGTACGAGCTGCTGCGCGCTTTATTGCGTGCAAAACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCCGATCGTGATTGTGATGAAAAAGAACG
GGCTGGACATCCGGCTCTGCATTGATTACAAAATGGTGAATGCTATCACCGCGATCATGGAGTATGCAATGCCGCTAGTCGACGACCTGTTAACCGATCT
CGAGCGCTACCTATGGTTCAGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGACCTTGCGAGCACGTAAAGTATCGGCGTTCGTCTGCGCA
CTCGGACACTTCGAGTGGTTGCGCATGCCCTTTGGATTAAAGAACGCGCCGATGATCTACCAACGTATGATTGACAACGCACTCTGGGGGTTCGTTCAAC
CTAAAGGAGGTTGGTTTGAATACTCGGAGAGGATGCGTTCAGCTGAAGAACAGGCCAAGGAACGTCGTGGGCCAAGCACCGCGGGTTCGTTTCAAACGAA
GTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGGGCCAGACGAA
TCATCGCTGGTACCTGTATTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGC
TGGCAAGATTTGCACAGTGTCAGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGG
TATCAGAGCTGACCTTAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGCAAGAAGGGCATGCAGTCGTTTCTTGGAGCGGTTAATTACTAC
AGCAGCTTCATTTAAGACTTTGCGGTCTACGGTGCGGCGCTGTACCAGCTTAAGGATGAAGACTTTGCCGCTGAAGGTGGCATTTCTGTGGCACGTCGTT
CCTTCGAGAAATTGAAGGCGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGATCGAAGGCAGTTCACGTCATGCTCTTTGCGAATGAATGGGC
GTTGAGTACTACGCTGATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGTGTGCTCAAGGAGGCCGAGATGAACTACCATCCTGCC
GAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGTTCTGTTTCGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACCCGATTCTCGATGTTAGAGT
GGGTGCACAAGTCGAAGTCTCTCTTCGGACGCGCCGTCCAGGTTCGCCGTGCTGCTTTTCGCAGTGACATTAGAACGTGCAGCGCGTGAAGGAGAATATG
TCCGCCTTTCGCGCAGCTACCGTCAGTCAAGCATCACGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGTGGCACCTCCAAACAAGGGTTCCCCGACTATACGAATGGACGCCGCGTTGATGTAC
GTCAGGTTTTCCCGTAATTACAGCGGATTCGCCATGTCTTTTTACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGGTGT
GGAGCCTTCCTGAGTGGAAGATAGTGATTGCTGCAAACGCTTACCTCTCGGCCACCACGGTGAATGAAGCGGAGTATACAGGTATGATAAACGGTGTCAA
GGCTGCTATCGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACT
TTGCTAGCGCGGCTGAATACTCACAAGGAACTCGCGGCCAAGCTTCGATCACTTAAATAGCTTCACGTTGTACGAGAATACAACGCTGCCGCGGATTCGT
TAGTCACTGAAGCGTTGGAATCAAAGGTCAGTCGGGTCATCTTGGCTGAAACTCGCAAGTCGGAATTGGCGTCGCTGAATCGCATCCAGGAAATGATCTA
CGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACGTGGAGCAGAGCGTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAA
AATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAATATGACAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAG
ATGAACACTCGGAGGAGGTCTCAAAAGCTTAAGAAGAGCATGAAGAACGACGAGAGACGTCCACCGAAGATTCAATCGGCCAGGATTTGCCAGACCATCC
TCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAAGATGTTGACCTGGTAGCGATACAGCGGGAACGACGCAGACGGATACTGGTGGCACAAGACGAG
GAGCAGAAGTGGTTTAACATCAAGAAGGTGTCTCAGGGCCAAGCAGAAGAGCTGAGTTACAAAGAAGCTCGAGATGCCTGGAAGTATGCTGACCGGTTCG
TGTTATCAGAAGACGGCGTGCTTCACTATCTTGAATTGAATCGTCGGTACGACCACGGTTGGCAAGGGGAGACCAAGCTGCGGCTTGTGGTACCAACAAC
GATGATTCAAGAGGTCTTGCAGAACTGTCACGACTCGCTGGAAGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGTTAAGTTCGATTATTATTGG
ATCGGCTTGTACGCTGACGAGGAGAAGCACGTGAAGTCATGTCCAGATTGCAGCTCGAGTAAAAGCCGTCCACAGCTTCGTGGATACTCGCCTGGCAGCG
TACTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTC
GTTCACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAGTGCTCGAAGAATGTGTGTACCGACGCTTCGGGGCCCCA
TCATTAATAAGGCATGACCGCGACCCACGCTTCATGAGCGAGGAGTTCCAAGCGTTTGCAGAGATGATACAGTCAAGATCACGAGCGACTTTGAGCTATC
GGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCAGTGATGGGTTCCGTACGGGTGTACGCGGATGACCCTCTACAGCAAGATTGGGACGAAAT
CGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACCTCGTTCATGGTTGGGATGCGCAGTCGACATTG
AGGGCAATGTCGTCATCACTCAAACGAGGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGCGAGATCAATCGACAACATGAGGTCGCCCTCACTA
TGGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGAAGGGCTAAAAAGCATAATGAGGCCCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGG
AAACGAACACTCGGCTGACCCCCTAGAAGCTTCAGAAGAGATGGAAGATCCTGCAAGAGCCCCACCGAGATCTCTTTTTGAGATTGGGAGCCGGGCGTGG
TTGTACGTGGAGCACGTCAAACCGGGCTTGACGAA