Description :
From Genome Similarity Track
Location :
Scaffold_1801:4824- 6646
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1801-snap-gene-0.1Pyruvate dehydrogenase [lipoamide]

Sequence
1822 bases(100 bases per row)
GAGCTCTACGCGGATCGTTCGCTGCTCGCAGCCTAAAGAGGCCGAGCGCAGCCACTCGAGTGGCTCACCGCAGCTTGTGAAGCACGCGCTAAAGTAACGC
GAGACTGGATCATGTCGCCCACTGCTTCTGCTGCTGTTCTGGTCCGTCTCGGTGGCGTAGAGAAGCTCGATCTTGGACGGCGTCTCGCCCCGTTTGGCTA
CAACGCGGAGGCTGTGGATCGTGTAATGTGACTTGGAGATAACCTGGAGCCCAAGTTCTTGCGGGTACGGGGCGTTACTGATCAGCAGAGGACGTTAGCA
AGCCCACAACCAGTCCAACTGACTGCACCAGGCAGTACCTGTTGGACGTCCACACACTCGCTTCGCTATGGTCCACCGCTCCGGGGACCCACGATCGCCC
TGCACGAGCCTGGCTCCAGCCACCTTGGCGCTCCATCGCGAGCGCGTTTGCGTCAATCACGCGGAACGGCACGCTCTGCATCAGCTGCCGGTATTCTCGC
ACTGTAGTGAGTCACCTGCGAACAGCTACCAACCACCAGGAGAACCTCTATTTTCAGTCCAGCAGCACCTCACAGACTAGTGTGACGAAACGGAGGTAAT
GCACACGATGGAGCTTCAATTCTGGGTTACCATTGCACCAGAGGCGAACTTGCTTGGGCCTTGAGCTCTTGGTGGTGGTGGTCGGGCTACTTGACCTCGG
AGGCGCCCGTGAGGCAGTTCATGTAAATATACGCGTCCACGCCGTGTCCCTCCATGGGCATGAGCGACAGGTCGCCGCCAAAGTACTTTGCGTGCAGCGA
CGCGATGCGCAGCCCGAACGAGTCGACAAAGTCCATGCCGCTGGCGCGTCGCTCGAGCGCCGCGGCCACGGGGTCGTAGTGACTCTTGCCGCTGCTGCTG
GCGGTCGCACTCACGGCCGCCTGGCGGTACGAGAAGAGCGCGTTCGCTTGCTTGCGCGTCATGCCGCCGCCCAGGTCCGACACCTTGATGCACACGCCGT
GCGAGCCGCCGGCGACCAGGATCGACACGGGTGGCGGCGTGGACGAGGACGCCGCCAGGCTGTTGACCACGGCGTTCTTGATCACCTCGGACAGGATGAG
CTCAATGTGCCGCGGGATGTATCTGTAGACAGCATTCACGTCCCCAGAGATGTGGAATTCCGGAAGTTGCTTGCCGCTGGCGAGGCTCTCTTGCTGCCAG
CCGGGCTTGACCTTGTCGATCACGGACTGCGCGATCTGCACGGGCGAGCACTCGTCCGCAACGATGCCCGTGAAGCCCGCGACGGGCTCCTGGGCCGCAA
GGTGCTGGTCCACGAGTGTGCGGATGCCGATGCGCGAGTTGTAGAAGTTGTCGAGCGACGCGCTGAGCCCCTGCGGCTCGTACTGGAGCTGGTGAATCGC
GTCCGCGACCTCGGCGTGCATCGTCGCGTGGTCGGTGCGCAGCCGGCGGTGGATATCCATGAACGCGCGCTCGCCTTCGAGACTACGCGGCAACGGGAAG
CTGATGAGCTCGTCGAAGGACGCGAGCAGCTTCTCACGCAGCTTAAGGATCGACGGCGCGTCCGGGAGCTCATCCGGGAGGTTCTCGAGGTCCACGATGC
GGCGCGCGAGGCGGATCGGCACCTCGCGGTGCAGCAGCTGCGCCGACGTGATGATAAGCGGCGAGTTAGCTTCCTTCCACTGCGCCAGGCTCGACGGGTC
TTCCTGGAGCTTGGCGAGGACTGTGGGGGAGGCGCGTGGGCCGCGCTTGAGCAGCTCCTGCAGCGTGATGGCGGGCAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN