Description :
From Genome Similarity Track
Location :
scaffold_3:482305- 484709
Sequence
2404 bases(100 bases per row)
GAGTTTAACCTCAATGATAACTTTGTTATCATCCTAGGCATGTCATAGTTGGAGCATTATTAGCGTAGCATTGACTGCATGAATATGAAGATCGTCGTCA
AAAAGTCGTGCAGCGCTTACTCGAGCTGCATGATGATGAACGAAATGGTCTGGGCATATACATCTGGTGAAGATGTCACAGATGTCCCAAGTAATATTGT
TGTGTGCAGTGCCCCCCCCTTCATGATCACAGAACAAGCCCAAAAGACGAAAGTAAAGACATTCACTGAGGTAGAGCAGTCAGGCACCAGAAAAGACAGT
CTCCTCTGATATCGACATGGAAGTCAAGGTCAATGGTAGAATAGAGAATAGTGGGGTCAGAGGCAAAGAGCCATCCCGAGAGAAGAGTAAGATGGCAACT
AAAACAGTTACCCGTCGAGTATTTTGCGTGCCCCTGATCAAGGGACAAGTTGTATTGGTGAAGAAGGTGTTCAGGAACAAGACACCCAAGCGACTTTACA
GTTGTGTGGTCTAGGATGACTTCAATATTATCCGTCACGTGAAGTTAGGTGATCCTCCAAGTTTAGTCAAAGAATTGTTTTTCTTGCCGTTGATGAGCAA
AAGGACGCTGAAGCTAGCCTGGCGAAAGGCGAAATCtcgcaaatatgtgcgatTGTCGAAGAAACTGTCGACGATGACATCAATACTGCGGAAGTATTTG
ATGAGAAGACACGGAAGGAAAGGTTTGATGAGCAGTCGTACGACGCTCTAAGGACAAAGTATGCGTACAGACTTGCCTAGAACTTTGCTGATTTATTTCC
AAACAAGATGCCGGGCGAATTGCTATCTGACATAGACATTCTTCATGAGTAACACTGCAGTGACCGTTGCCTTAAGAACAAGTCTTTGCCATTAACGAGT
TCTTTGTGCAACGACAGACGGGTAGTCACGCGCGTGAAAGTTGGTCTCCGCATTGTAGTCCGAACTTCTATGTGAGGAAAGCCACAGGTGATTAATGCAT
TATTCACGCTTTTGATAATTGAGCGATGCAGCCATACCTGCCCGAGTTTTCGGTTTCACGCAAGGTGTTGACTTTTGATGGAATGGTTAGCCGTACGACT
TTCATTGCCATCGATCTGAAAGATGGTTTCTATCAGATACATATGCGCAAAAGTGATACACCACTAACTGCAGTCAGTACCCTcagtggtatgctgtggG
AATGGTTGGTGATACACTAGGTTCAACGAGCGCTTCCGCAAATTTTAACAAAATGGTAACGAATCTTCTTCGTTCATTGCGAGAATTTGCTCCGAGTTAC
TTTGACGAGATATTTGCTTATGGTAAGAAAACCGGTGAGGTCTGATgtcgatgttcatcttgatcatcttcgtcaGGTCTTTCAAGTTATACGAGAACGT
AAAGTCTACGCTAATATAAACAAGTGCATTTCCTTTGCACCAGAGATCCCCGTTCTAGGCTGCTTTAGGGACAAGAATGCCGTTCGTGTTGATCCGAaaa
agtcaaagctatcaaTGATTGGTATGTGCCAAACAATGAGAAACAGCTGAGACAATGGTTAGCTTGGCCAATTATTAACACAAATTCACGCGCAACTGTG
CAGCGTTGATGCAACCCCAAACgactcttttgaagaagaacaTTGAGTGGGAATGGTAAGAGATCATTAAACGGTATTTGCCGAAGTAAAGATGAGCTTA
AGAGAATCTTCTGTTCTTGCGATTGTGAGCCACGATAAGCGTTTCCATAGCAATTGATTATACCATCGGTTGTGCGCTGATGCAACACGACGATGAGGTT
CGAGAGCAAGTTGTTTTGTATCAGTCGCGACAACTCCGGCCTGCGGAACGGAActatccagttcatgacaaataCTTTCTATCTACGAAGTATGCTCTGG
TTAAGCTCCGTGTGTACTTTTTTGAAGTGAAgcgctttgcgatctatacagatcatgtaTCACTGCGTACAGCAGTATAGACTCCTCAATTACTGCAAAG
AATAGCTCGATGGATTTATTCTTTGCGTAGTATAATTTTGTTGTATTCTACAAGCCAGGCAAGATGAACATCTTAGCCGATGAGCTGTCAAGAGATTCGG
ACTATGATCCAATTTCCAGGAGCGAAAATTTTCACCAttcatgtcgacaatgcgaaGATGTTTAGACAATCAAAATCAACTATGACTACATTGAGCGAAG
AAACTGTCGAAGAGTACAATTCTAATAAGGCATGTCGGGACTTGTTGATGTATTTTTATGAGCTTTTCGtcaaagcactgcaaggtcTTCCGACTCGCTC
AAGATCGCGCGTTCACCGTTTTGGAGAACACGACGGATTGTCGTACTATGCGCGGGGACACAGCAAGAGTTGGTGATCCATATGACGAGGGTTGCGTCAT
CGTC