Description :
From Genome Similarity Track
Location :
scaffold_85:48228- 49510
Sequence
1282 bases(100 bases per row)
CGTCTTTCTGCTCGGTGGATTCCTGCTGACATTCGTGCTACTACCTATCTTCGCGTTCGTGGCCTGTGGGTTGAGACTGCGACTCGTGCAACTTGGGATC
TCGCACGGGATTTACTCACTGCACGGGCTTGCAGCACTGGCATTCGGACCAAAAGGTGCAATCATGTCAGCGCTACTACAGCTCACGGTCTCCGGTGGTC
TCATTGCAACGTATCTCGCCATTCTCTTTCATAACTTGCCGGTATTATTGGCGCAGGCTCTGGATCTGAAGCTGGACTGTGATGATTCATCTAAATATCC
GACGGCAGTCTGGTTTCTCAAGGACCGTGTACGATTCGCAGAGATCGTGGTAAGTTCGTGGCTTTCTGGATGGTACACGGGTCTTGACTTGCTTTCTGCG
TTACAGACAGCAGTAGTGATTCTTTTCTGCCTGGGGTGGTCCTCTCATACGAAGCTGAAACGATCGTGCATGGTGTTGGCACTGGCACTCTTTGTCGCCT
GCTTCTTTGTTCTCGTGAATACCCCTGCACTCCACAAGAGAGACGTTCCGTTGTTTTCAAGGGGCTTTTCAGATGACTATCTCTCCATGCACATTGCAGT
GTGTCACTCAATGGCGATCTTAGCGACGTCTTTTGCGAGTCCGCACCACATTTTCCACTCCTTTTACGCTCTCCGTGAGCGTTCAATCGGTCGATTCGCT
AGGTTGTCAATCGGTTCCACGCTGATATCAATTTTCTGGGCACTTGGCTTTGGTGTTGGCGGATACTTGTCGTTTCTATCGGACACCAAGGCCGACGTCC
TTCAAAATTATATCAGCACCACAGGCGATTTACCTTCGAGGAATAGCTGGGCGTACTGGATCTTGATACCTTTTTGTGCTATTGTGTGCATTGCACTTGA
AGTACGTTATTTTTTCCAATGCAGCACCCTGTTTCGAGGCTCTGACAAAATCCATGACCTATGTTTGCAGGTTGCTGTATCTCGTCACACCTTCCTGTTC
TTTTGGAGAGCCAATTTTTCGCTGGACATGGAGAAGAAAGATATCCTTTTTTGGTCCCAGACAGCATCGTCTCAACTCAAATCTGGTCGTCGAGAAGGGC
GTGGCTTCAGCTGGAAGAGCTCATTGATCACAGCTGTTGTCGTTTTTGCGCTCGCTCAAGCAGCCATTTTTTCACAATATACGATCGCAAAGGCGATGAG
TGCTACCGGCACGTTAGGTGGGTTCTCGCTGCTGTTCATTCTGCCTGCAGCGTGCCACTTGAGGTTGACTGTGGGTGACGAC