Description :
From Genome Similarity Track
Location :
Scaffold_309:482- 4200
Transcript NameFunction/comments
Phypl_g6782hypothetical protein

Sequence
3718 bases(100 bases per row)
CGATGTTAGCGCCGACtgtgtcggcgctgctgcagcccctCCCCCACCAAGAGTNAGGACGTCGCGTAGCTGCGCAGGACGTCTTCGAGAACCCGGTTCA
CGCGCTCCGTTTGCCCATCCGTCTCCGGATGGGCCGCCGTTGACATGAGCAGGCGAGTGCCCAGCAGTTCGAACAGCCGCGTCCAGAACGCGGAGGTGAA
GCGAGGATCGCGGTCCGAGACTATGGACTCCGGAAGGCCATGGTGGCGGAACACCAGGCGATAAACAGCGCTGCAGAATCTTCGGCAGTCACTTGGGCGG
CGACTGGAGCAAGATGGACCATCTTGCTGAAGCgatcgacgaagacgaggacaCCCGTGCGTCCCTGGTCGTCGCGCGGGAGCCCGAAGACGAAGTCCAT
GCTGACGGatcgccacgcgctcgtggcgaTGGGCAGCGGACGCAGCGGAACTTgcttcgacgccgccggcttAACGCGCTGGCATATCTCGCAAGAGCGA
ACCCACTTGCGTACCCATTTGTACATGCGGGgccagaagaagtcgcgAGAAAGGGCTGCGAACGTCTTCTCGCGACCGAGATGACCACCGGAAGGAGCGT
CGTGGTACTCGTGAACAAGACGAGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTGGCATGGCGAGCCACTCCCAGAGCATCCCGCTGGGAGTGCTTACAGCGGTCAGAGGCACGTCTTTTCCTCGCATGAGGATCTGATAGAAGCC
GTCCGTCAGATCAATCGCGCTGTAGACGACGCTGCCAGACATGGAGTCCAGCGTCATGTCTTTCCGGGGGATTGGTGTCTGCGCTGGGATGATGGCGTCG
TTCAACTTGTTGAACGCGTGAACGATGCGCCAGCCTCCTGTAGCCTTTTTCACGCAAAAAGTCGGGCTCGAGTATGGAGATGTGCTGTCACGTACGTGCC
CGGCCTTGTGGCGACccttgaagaagtcgtcgacgGCTTGGACCTGGTTTCGCGGCAGTGGCCACTGCCGCGTCACGCAGTATTTCGATCCGGGCACGAG
GTCGNGCAAGCGGATATACTGGGTTACCAGAGTCTTGGAGCGCTGTCCAAGACTGCGCGATGAGGCGCTCTTCGCGGGCTGACTTGGCCTCAGCCGCCTT
CGgtcacgacgacgatgcgTCGTCGCTGACAGCGTTGCCGCTGACGGCAGGAGGGTCGGAACTCGTGAGGAGGCACAGCTGCTCGACCACGCCGGCCTTC
AAGTCGCGAAGTAAATGCTTCCAGGAGAGACCCGGAAGCCGCGTCGGAAGGAAGGTTCGCTACTTCGACGCACCGTACTCGGTTTGGGGATCCCTCTGAG
TATTCGACTACACTGAGCACCTCGGTGGACGGGGTGTCGGTGAGCGCGGAGGGCGATCGCcggagacgacggcgtcCGGATCTGTTGCACTTGGACTTCC
TCAGTCGCCTCAAGTGTCCACTCGAGGCCGAAGATGCGCTGGATGATGATTCGCTGGATGACACGTCACCCTCCTCTAGGCGTGGGAGCTCACTCTCGAC
GAGGCCGGTGTCGCGCAGTTGTTAGTCCTGCGCGACGGAATCATCAGCGGACGGGAGCCCCNNNNNNNNNNgcgcgacgaggaggtgagTGAACACCTCG
CTGACGTCGTACCCGACACGGCGTCGGACCGAACGGGCTATCCACGGCATCCCCAAGATGCAGTCGAAGGCGTAGTTCAGCTCGATCACCAAGAAGTCGT
CGTTGGTGCAGAAGCCGTCGAACTTGTACGACAACGACACAGCGCGCCGCGGAGCGCGGTGTGGCTTGCCGTCAGCCAACTTCACGACGATGTCGCCAGG
ACTTTCGCGAACGCGCACGTGCGATGGAAGGAGAGCGAGGCAGTCGTCACGAATGAAGTTGTTCGTGGCTCCGGAGTCAAGCAACGCGCGGAGCGGGCGC
TCCGCGCCGGCGACGTGAAGACTGATGAGGATCAGTCTCGAGTCgccggacgtggtggtggcgttgaATTGTGCGTACAGCACAGGGGGCTAGGAAGGCC
AGTTGCCACCGGTGGACCGGGTCTCCATTCCAGCTAGTAGGGCGCCCCGCGCCTACCGTGTTTTGGGTAAGCTGCCGAGAACTTGTCGTCGGATTCGCCG
ACGACCTCAGCGCTTGCCAAGACCNTTGTACGACCTCGACTCGGCttcgatggcgtcgatctccatgggCTCGGGCGCGGAGACCCTAGCGTCCGTCGTC
AGCGTTCGCACGTAAGAGGATGTCACTGTGTAGTCTTCGCGCAACGTGAGAGCGAACGCAGCCTCAAGTATCGTCGGCTCCGCTCGCGTGAGGCAGTACC
GCGTCATACCCTCACGCGTACCGAAGATGAACTCGTGTACTTGAGATTGCAGCGTCGATCGGGTTCGTAACGATGCACGAAACCAGGTGACGCATCTTCT
GAACGTAATCGCGCATGGACGTCTTCCCTTATCGGAGGGCAAAGAACGCCACTCGCGTGCGCGACTCGTCTTGCGGGGGCTCGAATNCGAATGCGAGGCG
CAGGTCACTCTGGATGGCTCCCAGAGTGGGGAAGGCGGTGGTGTCGGTCACCAGCCGGCCTAGCGCCCACTCCTTGGCTTTCCCAGTCAGTCGGGAAAGC
AAGAAGTTCACCTTCGCCGACTCAGCCTCGAGGAGTCTCGAGGCGATCgcgatgtcgatctcgcggAACCAGCGATTCAGTGGTAGGCGATCATGGCCGA
CCCCGGAATATGCGGAGGTGTCCATCTTGACGACATCGCCCTTCGTGGAGCGCGAGGGAGTTTTTACTCGCCGATTGGCTTGATATGCATACTGCACGAC
CTGAGGTGCTTCATTTCG