Description :
From Genome Similarity Track
Location :
Scaffold_1428:482- 1882
Transcript NameFunction/comments
Phyag_g10600hypothetical protein
Phyag_g10601hypothetical protein PHYSODRAFT_538076

Sequence
1400 bases(100 bases per row)
TGAGAAGTGCTCAATGTGCGCGGGTTGTGGCCAATTGGTGTGGTTCGATGTGACGAGGCCAATCGCACGCATTATAGCGGGACGGAGATAATTAGGGAAT
GTATGGAGTATCGGTGGAGGACAAGTATAATGTGTTTGAAAAACGGTAGCGGTTAGCGCTTGCGACCCGGAAAAAAATGGGCTTTCGACAGTGGGATTTG
GTTTGGTATCGTTAGTGTAGAGTGGTGACTGCATCTGGCTTTACGTGCTGACCTTAATTATTCTTAGCCGTGGTGGACGAAAGTGTCCACAACGCTGGCC
GATTGCCAGGCAGACATCGGTCCGATTCTTCCATGATCTCATCCGGGTTGGTCGTGGCGGGTACCCTTGATCCAATCCAGGCGTGACGGAATCAAGGTCG
GCTTATTGCTCCACTTCAAAATGAGAGCGGTCACGGTATTTTTGTTTAGTGTGTCACACATAGCCAAACCATTTTTAGAAAAAAACTAAAATTATATATA
CTGTTTCTACACTTATATGTGCTAAATCTAGATTTAGCACATATAAGTGTAGAAACAATGAGCTGTTCTAAAACCGTTGCAGGCTTTTAGCCAGCCATTC
CATTGACGTTGCATCACTTGCCATGGCGGACTACGACAGCGGTtcggagctcgaggacgtggagaagatcgtgcGCGAGGCTCCCAAGCGTCTCGGCCGT
GACGCccgcaaggccaaggccaagaaggagcagacCAAGCCCGTCAAGCACGTGGGCAAGTACACGCGCAGTGGCGCCATCTCGCAGCATCGCATCCGCA
ACATccgcgacaagaagctcaagggTTCGCTGCAACGCGCCAGTGAGAAGCAGAAATTGGCGGCCGAATCCGCCGCCAAGTCTGAGATCTTGCTGCCCGA
CCAGGTCGGATTCCTGGAGGCCGAGGGGCTCGAGAAGACGTACAAGTTCacgcagaagcagctcgcggaCAATGTGGACCTCAATACTGCGCGCAAGATC
TTCAGCCTGGACCTGCCGGACTACGGCTCGTACCGCGTCAAGTACACGCGCAATGGACGCAACATGCTACTCGGCAGCCAGAAGGGCCACTTGGCCATGA
TGGACGCGCTGCGCATGAAGCTCACGTGCGAGTTCCAGGCCAACGACCTCGTGCGCGAcgtcagcttcttgcacAACGACTCGCTgttcgcggcggcgca
gAAGAAACATGTGTACATTTACGACAACACTGGCGCCGAGGCGCATTGCATCCGCACTGTGCCGGAGCCCAGGAAGATGGAGTTCCTGCCCTACCATTTT
TTGCTGTCCACTGTGAGCGGCAATGGATTATTGAGCTACCATGATGTGACGGAAGGAAAACTGGTGTCTACACACCGCACCAAGCAAGGACTGTGTGATA