Description :
From Genome Similarity Track
Location :
Scaffold_3:481870- 483204
Transcript NameFunction/comments
Sapdi_VS20SDRG_01291hypothetical protein

Sequence
1334 bases(100 bases per row)
ACGACGACCAAGACGAGCACGGAGCTCGCCACGGACGCCTTATACATACCTATCGAGACCCTCAAGATGACGCCATGTACTCACGACGTTGCTTCAAAGG
TAGCGCACATGCTTTTGCGAGTGGAGATCGCAATTCATCAAAAGATCCGATCGGCGCCGTTTCACAAACCCTTTGTGGCATGCGCTTGGTCGTCGCCGTC
GTTGCCGCGCTGCTTTGCCTCGGTGCGCTCATGTTGTGGTGACCAGCTCTTTACCGATGTGGGTAGGCACTGCGCAGCTGCCGTGCGCCTCGTACACGCC
GCTCGAGGCGGTGCTCGAGACATGCGTCTCGTACGACATGCCGGGGTCTGCGCGCATGTCGTAGCAGCACGCCTCACGCGCACGTAGGCCTAACACGGCG
CATGTGTTTCACACGTCGTCGGCGATCGCGAGCAGCTCTGCGCTCGTCGTTGTCGGCGGCTACTCGATCAGCACGGGCCAGCCCGTGATTACGAATACAG
TCCAAGTCTACAGCCCGTCGTCGCCGCAGACGGCCGTGTACCCTACGCTCTCGATCGCGTCGGGCGGGCCCAAGACCAACGTGCGTGACTGCAATGTACT
TCGTGGAAGTGATGGCGTGTGCGTAGACGCAGCAGTTTTTACCGGGTTCCCGCATCGAGCATTCGGCTATCGTCTGGGAAGACGCCATTTTCATCTACGC
CGGCACCAACACGGACATCATGGGCGATCTCTGGCGGTAGACAATCACCCTGTTCACGGACGTTTGATAATAGCATAGACTCTGCGTCGTCGCCCCGTAC
ACCTCGGGCATCTGTATGCAGACGCGAAGCGCACGATCGTGACGCTTGTCTAGGGGACCAGGTGCTGAATGCAACGACGTACACGCCAATAGCGCGCACG
GGCCACTCGACAACCACGCTTCTCGTTAACGCAACGAGCAGCGTGCACCTGGTCTTTGGCGGCACACTCGCATACTCTTATGCCGTAGGCTCAGCCACGT
CCTTGCCTGCCTCTGATGCTCGTCTAGGCGAGCAATGATACCGTATTCATGGTGTTGACCAAGCCAAGTCCCGGCCTCGGGTGTCAATCGGCGGTTCCGA
GCGTGACGTGGCAGCCTGTGACGCTTTTACCCAATACCTCGAGCCCGCTCGGCCGCGCGTACCACTCGATGACACTCAACCGCGACGAGACAAGCCGCAG
CTGCTTTGTCTTGTACGGCGGCCAGAGCCTCTTCAACAACTCGATCTTTAACGACGTGTGGACGCTCTGCCCGACGCTGCTGTCGGTACGGTCGCCAATG
TTGGACAACATGTCATTTCTCTTGTAGACGCAAG