Description :
From Genome Similarity Track
Location :
Scaffold_4:481797- 484948
Transcript NameFunction/comments
Physo_315983DNA topoisomerase putative

Sequence
3151 bases(100 bases per row)
GCGCTTCGCGGCAACCGCCAAGTCCTGCGCCCTCGGGTAGTCGAGGAAGCGCCGTCACCATGAAGCGTAGTCGTAGCAACAAGAAACTAGCTAGCCAAGC
AACAAGAGCAATCAAATTATATGTTTCCATTCATTACTTCAAGTTTTACCCCTCTTGACCTTGACGGAATCGTGTCGCGGGACTTGCGCGCAGTCTTCAG
CGAGTCAAACGCGATGTGGGCGACATCGCCCGTCCAAGCGGTACCGATTCCGGGCATGCTGCAATATTTGCACAACGAATCTGCGCTCGAGCAGATTCCA
GCTGGTGTTCTCGTCAAGGCAGCGGAGAATGGGCACTTGGATGTGGTGCGCTGGGTTATTGACTGTGACTGGGACGAAGAGGAAAACGAGGAAGATGGCG
GTGACGAGGACTATTTCGATACGCCGTACCTGACTTCGCTCGGTGGTGAAGCAAGTCTTGCCATTCACGCTGCGGCAACGAACGGCCATCTTGATGTTGC
GAAGTACCTCCACGCTCGAGTTGAGTTGACTGGCCGATGGATTACAAGGAACAAGAGCTGAGTTCCAAGCGTCAGACCATCAGCCTCGAAGCAGGTACTC
GGCGACGACCACCCAGCGGCGCCAATTTCGAGCGACACGATGCTGACAGCCGTGAGAAAGGGGTTGGCGGAGGTGGTGAAGTGACTCTGCCTTGAGTTTA
GCTGCAACGACACGATTGATCTCTTCCTGCCATCGCATGGAAATGGTTCAGCGATACATGTGATGGACGAAGCTGCAGCCTACGGACATTTGGAGATCGT
GAAACACTTTCACGAAATTGCATCAGCGCTCAAGGCCGAGTTCTCAAGGAGCGAGCGGATACTGCAGCGGAAAAGGTGACGGGTGCGATGTTTGAGCAGA
AGCGCAATCGCCACGGCATTCAATGCACGACAGCAGCGATGGATGGAGCAGCAGCCAACAATCACCTGGAAGTCGTCAAGTGGCTGCACGAAAATCGGTC
CGAGGGATCCACAACCGATGCGCTGGACCGCGCAGCTGGAAATGGCCACATCGAGGTGGTCCAGTGGCTGCACGCTCATCGGGCTGAGGGTTGCACCACA
ATTGCCATGGATGCAGCGGCCATCTTGGCGTCGTGAAGTGGCTCCATGAGCACGCAACTGAAGGGTGCCCTACACAAGCGATGGACACCGCAGCGGCGTC
CGGTCACCTGAGGTTGGTCAAGTGGTTGCAAGACAACAGGCTGCACGAAGGACGCAATGAATGGTGCAGCTGAGAACGGGTTGTAAAGTGGCTCCACGAG
AATCGCAGTGAAGGGTGCACGGAAGCGGCTATGAATTTAGCCGCAGGAAGTGGAAAGCTTGAGTGGTGAAATTTCTCCATCGGTATCGAAGCGAGGGCTG
TACAGTACACAGGACGCTATGATTGGGGCTGCGAGAGGTGACCACGTTCGAGTCATTGAATGGCTGCATGTGAATTGCCCCGACGATTGTTCAGGTCCAG
CTATTGATGAGGTCACTGCACGGCGCTTGAGGCTACGCTGTTCCTCCACCTGGTTCGGAATGAAACGATGAGCCCAGAGGTCATCTCGAATTCCATGGTG
AAACATCACCTGGGCATTGGCCACTTCATTGTGGATAACATGCCATGATCGGTGGTATAACTCGAGCTGGATACGGTTCTTTTTAAGCGATGGGGACACT
CAGAAAGCTAACGGATATCTACTATATTTTATTCTTGTTGCGGTACAAGGTTCGCAACGTCGCAATGTTTGAATGAAGCAATTCGCGCTGCATGAATTGC
CGAGACGAAACTTGATTGAATCGATACACTTACCAGATTCTTTCAGCTTTGAAACTAAGCTGAAGTAGCAGCGGACCAACCAGATGTCGAGCAGTGAAGT
GCCAAGCCGCTTGAGTCCTGTTGAGTCGAATTGAGAACTGATTGATTGAATGAAGTTACTCCTGGCATCTCCTAGCAGCTAGACTACTCATGTAGCGCCT
TGAAGACACCCTGTGTACCCAAAGCAAGGGTTCAAACGAACCCAGAACGAAACTCAGATGAAGTCAACCCTTACGCCAGGGAGAACAGGCGCTAGTGTCG
ACAGGGTGCAGAAGGAGTTGTCAGAAGACTGTGGTCGCCATGACACGGCGGCCCACCTCCGGCAATACCCGCGTGCTTTCGTTTCCGCTCGTGCCTTCCA
GTTGCTTGCTATAGACTATAGCCATGACTTGATAAGGTTTTGCTGTCCAGTCAGGAGCTGCAGTGCCGACTAGCGTCGTGGGCAGTCCCTTAAAGATGTC
ACGAGTCCGAAGGAGGACCAGAGCAACCGTCATCCGCTGCATTGAGCTGCTGCGGGCTCTTCGAAAAAGCAGAGCCGAAGACTACGCGCAGATGGCGAAG
GCAGCTAGAAGGTTACTTCTGGTTCGATATCGTTTTGGCATTTCGGTTCGCGTGGAAACACTGAATGTCCGGTATCCCGCTCGAACGTGAAGGACTGCGA
ACAGCGCTAGCCTTACCAGCAAGTGTCACCGTAGTATATCGGCGTAATGGACTGCTAGGAGCTCGTGGCGTTGTTTGGCCAGCAATCCCTGCTGCAGGAC
CACCAGTAGGTGCGTTCACGAGTAAATTACGTAATATATGAGTCTATGTTCAGATGTGTGATGAAATTTACGCCGAATTCTTCCACCAAGTAGGAAGAAT
CTTCCTGGAAGATGGAGCGGCGCGGCGTGGGCAAGCGGCTCACCGACGGCCAGCGCGTGGAGATCCTCAAGCTGCTCGACAGCGGCGCCCTCGTGAGCGA
GGCCGACGTGGCGCGGCGCTACGGGGTCACGCGCTCGGCCATCTGGCGCTTGCGGCGATCAGGCCGCCGCATTCTCGAGCGCTACCAAGAGGGCGACCTC
CAATCTCGGAACGAGCGGCGCCGCGGCTCCAGGCCCAACCACAGCAGCGGCAGCAGCAGCGACGCCCAGTCAATGCAAGCGCTCGGGGCGGCCGGGCCAG
CGCCAGTGCCAATAGCAGCAGCAGCAGCAGCAGCAGCGCCCGCGATGCATCCAGCCAGCTCGATCCGGCCGATCCCGGCCCCCGCCCAAGTGACGGCCGA
CTGCCGGCCACAGCCACAGCAGACGCCGCGACATCAGCAGCAGCAGCAACC