Description :
From Genome Similarity Track
Location :
Scaffold_50:481722- 489824
Sequence
8102 bases(100 bases per row)
CGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGC
GGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGA
GACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGG
TGGCTGTTGTTGAGTTATGATGCTCCTTTGGCATAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTT
TGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAA
CATCTAGCCATCATGTGCGTCTCTTCATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGC
TCTCAGTTTATTTGTGAGCCGTTACTAAAAGGCAATCGGTCTCGTCGTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGC
GTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACC
ACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGT
GTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATGTCTTGCAGGTGATGCGT
ATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCAGAAGGTCGCCAGTTCGA
GCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGT
GCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCTCCGTTGCCATCCTCATTGGCTCGAGCTCAAGCCCGAGTG
GGGCGTTCGCAATTTGGAAGCTCTCGGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACACATTGCAAT
TCCCACACAAATATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTGGTCCGATGCGAAATGCGCCAGCCATCACTTTGATTAGAAGATTGGCTCTGGCA
TTTGTGACCGAGGATGCATCACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGCGAGGCTGACGTCGGGGAGGGATGACATCTTTTGGAGTGTA
GTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCATGCGT
ATCTCTTGCAGGTGATGCGTATTTTGATACGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAA
TCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTTTGCTATCTCTTACGGCGCTTACACGACCCCCACA
GCCTCTTACGCTCCAGTGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCGTTCAATTCGGCTTGCTCCCCGTTGTCATCCTCGTTGG
GTCGAGTTCAAGTCCGAGTGGGGGGTTCGCAATTTGAAAGCTCTCGGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGA
GACATACGACACATTGCAATTCCCACACAAATATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTGGTCCGATGCGAAATGCGCCAGCCATCACTTTGA
TTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCATCACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGCGAGGCTGACGTCGGGGAGGG
ATGACATCTTTTGGAGTGTAGTGGGTCTATGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCT
TGTTCGTGCGGAGCGTGCGTATGTCTTGCATGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTG
GTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTTTACTATCTCTTACG
GCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTC
CCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCGGTTTATCGTGAACCGTTACTCAAAGGCAATCGGT
GTCGTCGTAAGCGCCGCAGAGACATACGACACATTGCAATTCCCACACAAATATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTGGTCCGATGCGAAA
TGCGCCAGCCATCACTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCATCACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGC
GAGGCTGACGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCT
ACGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGCGCGTATATCTTGCAGGTGATGCGTAATTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATG
ATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATC
AGAGTTTGCTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGGG
TCGTTCAATTCGGCTTGCTCCCCGTTGTCATCCTCGTTGGGTCGAGTTCAAGTCCGAGTGGGGGGTTCGCAATTTGGAAGCTCTCGGTTTATCGTGAACC
GTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACACATTGCAATTCCCACACAAATATGACGGCGTGGCGGAGGCGTCGTCGTG
GCGATTGGTCCGATGCGAAATGCGCCAGCCATCACTTTGATTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCATCACAACCACACTGCTGAATAG
CGGTAAAGTGCGTGAAATGCGAGGCTGACGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGG
AGACGGTCACCGATACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGCGCGTATCTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTA
GTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCT
TTGCCTCTTTTTGCTCTATCAGCGTCTGCTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATA
ACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGGCTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAG
CTCTCAGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCTCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGC
GTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACC
ACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGCTTGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGT
GTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCTACGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCATGCGTATCTCTTGCAGGTGATGCGT
ATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGA
GCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTTTGCTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGT
GCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCGTTCAATTCGGCTTGCTCCCCGCTGTCATCCTCGTTGGCTCGAGTTCAAGTCCGAGTG
GGGGGTTCGCAATTTGGAAGCTCTCGGCTTATCGTGAAGCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACACATTGCAAT
TCCCACACAAATATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTGGTCCGATGCGAAATGCGCCAGCCATCACTTTGACTAGAAGATTGGTTCTGGCA
TTTGTGACCGAGGATGCACCACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGCGAGGCTGACGTCGGGGAGGGATGACATCTTTTGGAGTGTA
GTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGGTACGCCTGCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGT
ATGTCTTGCATGTGATGCGTATTTTGATTTAATTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAA
TCTGAAGGTCGCCAGTTCGAGCCTGACAGGGAGCACTTCTTTGCCTCTTTTTGCTCGATCAACGTTTGCTATCTCTTACGGCGTTTACACGACCCCCACA
GCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCGTCTCTTAATTCGGCTTGCTCCCCGCTGTCATCCTCATTGG
CTCGAGTTCAAGCCCGAGTGGGGAGTTCGCAATTTGGAAGCTCTCAGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCTCCGCAGA
GACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGA
CTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAGCGGTAAAGTGCGTGAAATGCGATGCTGCCGTCGGGGAGGG
ATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGGTACGCCTGCGGTGGTGGTGACGATGCT
TGTTCGTGCGGAGCGTGCGTATCTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTG
GTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATCAGCGTTTGCTATCTCTTACG
GCGCTTACACGACCCCCACAGCCTCTTACCCTCCAGTGGTGCATCACACCTTTCACTATAACATCTAGCCATCATGTGCGTCGTTCAATTCGGCTTGCTC
CCCGTTGTCATCCTCGTTGGCTCGAGCTCAAGTCCGAGTGGGGGGTTCGCAATTTGGAAGCTCTCGGTTTATCGTAAACCGTTACTCAAAGGCAATCGGT
GTCGTCGTAAGCTCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTGGCGATTCGTCCGATGCGAAA
TGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGAATGCATCACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGC
GAGGCTGACGTCGGGAAAGGATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGGAGACGGTCACCGATACGCCT
GCGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCGTGCGTATCTCTTGCAGGTGATGCGTATTTTGATTTGGTTGGCGTGGTGGCTGTTGTTGAGTTATG
ATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGGCAGGGAGCACTTCTTTGCCTCTTTTTGCTCTATC
AGCGTCTGCTATCTCTTACGGCGTTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATAACATCTAGCCATCATGTGCG
TCGTTCAATTCGGCTTGCTCCCCGTTGTCATCCTCGTTGGCTCGAGCTCAAGTCCGAGTGGGGGGTTCGCAATTTGGAAGCTCTCGGTTTATCGTGAACC
GTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACATATTGCAATTCCCACACAAAAATGACGGCGTGGCGGAGGCGTCGTCGTG
GCGATTCGTCCGATGCGAAATGCACCAGCTATTCCTTTGACTAGAAGATTGGCTCTGGCATTTGTGGCCGAGGATGCACCACAACCACACTGATGAGTAG
CGGTAAAGTGCGTGAAATGCGAGGCTGACGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCGTGTCAGCCGAAGAAGACCAGG
AGACGGTCACCGATACGCCTACGGTGGTGGTGACGATGCTTGTTCGTGCGGAGCATGCGTATCTCTTGCAGGTGATGCGTATTTTGATTTAATTGGCGTG
GTGGCTGTTGTTGAGTTATGATGCTCCTTTGGCTCAGTTGGTAGAGCGTCAGTCTCATAATCTGAAGGTCGCCAGTTCGAGCCTGACAGGGAGCACTTCT
TTGCCTCTTTTTGCTCGATCAACGTTTGCTATCTCTTACGGCGCTTACACGACCCCCACAGCCTCTTACGCTCCAATGGTGCATCGCACCTTTCACTATA
ACATCTAGCCATCATGTGCGTCGTTCAATTCGGCTTGCTCCCCGCTGTCATCCTCGTTGGCTCGAGCTCAAGTCCGAGTGGGGGGGTTCGCAATTTGGAA
GCTCTCGGTTTATCGTGAACCGTTACTCAAAGGCAATCGGTGTCGTCGTAAGCGCCGCAGAGACATACGACACATTGCAATTCCCACACAAATATGACGG
CGTGGCGGAGGCGTCGTCGTGGCGATTGGTCCGATGCGAAATGCGCCAGCCATCACTTTGACTAGAAGATTGGCTCTGGCATTTGTGACCGAGGATGCAT
CACAACCACACTGCTGAGTAGCGGTAAAGTGCGTGAAATGCGAGGCTGACGTCGGGGAGGGATGACATCTTTTGGAGTGTAGTGGGTCTGTGACACTTCG
TG