Description :
From Genome Similarity Track
Location :
scaffold_25:481707- 484469
Sequence
2762 bases(100 bases per row)
GGTCGTGTCGCTACAGTCAAAGGTCGATTCAGCGGAGCCACACTTGGCATCAGTTATAGATAATTTGTTCTTGAAGAATTTTGACCGTGTCAGGATAGGC
TCTGCCATATAACCGATCCTTATTAATCGTTATGGAATACATGGATGACGTACGTAGTGCAAAGCCGCCCTCCAGCCTTCCACTCAAACGTAACTTCGAC
ACGGAGTTGATCGTGAACCATGCCCAAAGCTTGCAGTACTTtgacagtggccactgtcgcgTGGGCAAAGTGAGTCCATTGATGAGTTCTCTGCTCTAAA
GCAAGCTGCCGGTTTGGCGACAGCGCACAGACGTTTTGTGTGTGTAAATCAAATGGTAttagcgtatcgttcacattTATAAAAAGTAAAATGCGCAGAC
GATTCCGACTCAAATGCCAATTCTGCATTAAGATGTCATCCACCACCGTATTATCGGCTGTACACAGTTTATTGTACTTGATTTGGTTGATGGGTATTAC
GAAATCTTGACGAGGAACGAGGACGTCCCTTTGACGGCTGTCAGCAATGTTATGGAAATGACTTGTGATCACAAGGACCAACCAATGCCCCAACAACGTT
CAACCGGTTCTCCTCACGTCTGCTTCGGCCACTGCAAATCTTCGCACAAACTTGACGATGTTCTCGTTCATTCGAAGGACGAAGACAGTAGATCTGCAGA
ATAAATGCTCTCAGAGCACCTCCGTGCAGTGCTTGAATTTATGCATGAATATATATTGCAAGCAAATCTTGTAGAGTGTATTTTCGGTGCTTACGAAGTA
CTGGTCCTCGGTTGTGATGTGGGTAAACATGTTGTTCGCGCAGACCCTGAGAAAGTCAAAGCAATCGTAGAGTAGCCGATGCCAAGGATTCGAAAGGATT
TGAGGAAATAAATTTCAAATATCTGCATCGCTTTCGCGTAACTACGCGGTAATGGTACGCCCACTATCACACTTGCTGAAGAATGACGTACCATGGAAGT
GGTTGTCTTCTTGTCAAGCATCCTTCGCCCAAATCAAGAACAGCGCGACGAAAGGACTATTACTTGCTTTGCCAGATTATACGAAGCCGTAAAGCGTGGT
GTTTGATGcttctgagtttgcaatcCGTTGCTACTGCAAAAGGACTCAAATAGACACGGTCGGGGCGTATCAATCGAGACAGCTGACGCCAGCAGAAAAT
AACTACTCTGTACACGACAAGGAGGTTTTGGCAATGACGTATGCTTTGGTGAAGTTTCTTGTTCACCTGTTGGGTTAAACTCCGTTTATCGTCTACATGG
ATCACGCAAGCTTGTGTTTTGCAGTTCAGTCTCCTCACTTGTCATAGCAAATGGCTCACTTCTTGTTACCTTTCGCAGAATGGACGGGTAAAGCCAGAAA
ATAGAACGTATGTCACATCAACCTGATTATAAGCCAGCTCATATTGGCTATATCGAATACATGATTTTTGATATGATCCGTCGAGCGTTTATTGAAGGCT
AACAGTTTGATTTGATTATCAAGGCACTCTTACTGAGTGATATGGACTCTATGACAAACGTTCTGGTCGCTTAAGTTCACGGATGCATCTTTATGGACTA
AAGAATGGTTCCCTCTATTCTGAAGTTACTCATGGCGACGAGCAACGGATTGTGGATCCCCATATCGATGTTTAGAAGCACAAAATCGTAATGGGGCGCA
TGACACTCCGATGACCGGTCACTTTAGCCGTGAAAATACCTATTAGACTCTCATCGCCCAATTTTGGTAGTCCCAAATTTACAAATGGGTGGCACGATAC
GTAAAGACAAGCGATATCTATCAGTGCGTGAAAAGCGCACAGCACACGCAAGTACCACTTTAGAATTTACCTATTCATCCTTAGTGATAAAACTCAGTCG
GTCTCGACTTTATTTTTGGCTTCCCTGAGCATGCCGATGGCTAAAATAGGGTGCTCGTCTTTGTTGCAGACTCAGTAAGATAGTTTGAATCGCTCTGTGT
AGCGATTCCATCGATGCGAAAGGTGCTAAACTGTTCATTGATCACATTTTTTGTAGTCACAGTTGAACAGACGCCATTGTGTCTGATCGTGACTTACGAT
TCACGAGTGGCTTAACGAGAAAACTGTTTCGAATTCTTGATAAATGCCCACAGCGGTCGACCCAGCTACCGATAGGCAAACAGAACGTGGTCGGAGATGT
GATAAGAAGCTTCTATTCGGAAAATCTCGCAGAATGGAGTTTGTTGTTTTCATTGGTATGGATTGCTATGAACATTTCGGTTCATTTATCCACTACATTT
GAGCCATTTTTGACGAAACTCGCAAGTACCGCTTTCTGCAATGGGTGGTGTCTCCGATGTAAGTGGGAAAGGAGCTCGACATATTGTTGCATCGCAAATT
AATACAGTTAATGACGCGATTGTTAAGCGCAAATACAAAGACGCCCAAAAATCATTCATCATAGGTTGTGTGAATGTTATCACACGGGTGCGAGACGCAA
TGGCGAAAAATGCGCAATATCTGCGAAAAACGCAAGGTCGTCAAGGCAAAATCTCTTTTATTGTGAGGGATTATGTCTTACTTAGTACTAAGAACCTATC
AGACGATGCGGTCTCAAGCTTGAGGTGTTTGCAGCTATTAACTCGCTTAATCGGTCCATTCCGAGTAGTGGCACGCCATGGAACAGCTTGCGTTATTGAC
CTGCCAAGTTTGCTAAGGACCCATCAACGATCTACGTAAGGGTTTTCAAACCCTATCGCGAC