Description :
From Genome Similarity Track
Location :
scaffold_114:4817- 6738
Transcript NameFunction/comments
g3896.t1hypothetical protein

Sequence
1921 bases(100 bases per row)
CGACGCGGACGGAGCCAACGATATGTGCACTTTGAACCACTTGCACGAGCCGGCGGTGTTAAAGAACCTGGAGCTCCGCTTCGCCAAGAAGATGCCGTAC
ACGTACACTGGAGCCATTTGTATCGCTGTGAACCCGTACCAGTGGCTGGATCTCTACGGGAAGCACCTGTACGAGCAGTACTTGGAGCAGCCGCGTGATT
CTCTGCCTCCGCATCCTTTTGCTCTCTCGGCGACGGCTTATATGGACATGAAGAGGACGCAAGTGGACCAGAGTATCCTCGTGAGTGGAGAATCCGGTGC
TGGTAAGACGGAGACCGTGAAGATCATGATGAACCACTTGGCTTCCATCTCTGGAGGAGGAAACCACGGCACGAAGGTCATTGACCAAGTACTGAAGAGT
AACCCGCTGCTCGAGTCTTTCGGTAATGCCAAGACAAAGAGAAACGACAACTCGAGTCGATTCGGAAAGTTCGCGCAGCTCCAGTTCGACAGTATGGGAT
CTCTTGTGGGTTGTCTCTGTGAGACGTATCTGCTCGAGAAGAGCCGCGTGGTCGGACAGACGGAAGGCGAACGCAACTACCACATCTTCTACCAGATCTT
CTGCCTGCCAGAGGACCGCAAGACGGAACTCAAGCTCAGTGGAGACGTCACCAGCTACAAGTACGTGACGGAAGGAGCTGACGCCGAGTTGACTGGTATT
GATGACGTCCAGTGTCTGAAGGACACCCAAGACGCTCTGGACACTATCGGTATCACACGTGAGGAGCAGAGTGCTATCTTTGAGATTGTGGCAGCCATTC
TGAACCTGGGTGAGGTCGAGTTTGAGCCGAACAGCAATGACAGTGAGAAGTCCCACGTCAGCAACGAGGACATTGTGGATAATGTCGGCTCTCTGCTGCA
AACCGAGAGCGCCGCCCTGCACTCGACGCTTCTGGAGCGCTCCATTACCGCCGGCTCCGAGTCGTACACGATCCCGCTGAATGCCGAGCAGGCCTCGGAC
CTGCGCGACGCTCTGGCTAAGGGCATGTACACACAGCTGTTTGACTGGCTCGTGCACCGTATCAACAAGGCTATCTGCTCTACGAACAACGTCAATACTC
ACATTGGTCTGTTGGATATCTTCGGCTTTGAGAGCTTCGACCAGAACGGCTTCGAGCAGCTGTGCATCAACTACGCGAACGAGAAGCTCCAGCAGAAGTT
CAACAGCGACGTGTTCAAGGACGTGCAGCAGGAGTACGTTGATGAAGGCATCCCGCTTACACTAGTGACGTTCGAGGACAACCAGCCCATTCTGGACTTG
ATTGAAGGTCGTATGGGTATCGTCAGCATGCTGAACGAGGAAGTGCTTCGTCCCCAGGCCACAGACAGCACGTTTGTGAGCAAGGTCTTGGACGCGTGCA
GTGACCACCCCAGCATTGAGAAGAACCGAATTAACCCGTTGGAATTCACCATCCACCACTACGCTGGTGATGTGACGTACAACGGTACGGGCTTCCTGGA
GAAGAACAAGGATACTCTTCCTACGGACATGGTGCAGCTTTTGTCCGGCAGCTCTAGCGGTGTCATCTCGGGCATCTTCACGCCCACGCAGAAGGGCACC
AAGCGTAACAGCCGGGGCAAGCATGGCAAGGAAGGCCGCCAAAAGGGTTTCCTGGTGGGAAACACTATCGCCGGTGCCTTCCGCAAGCAGCTTTCGGAGC
TGATGGTGACCATCAACAAGACTTCGTCGCAGTACGTGCGCTGTATCAAGCCGAACGCCAACAAGAGCGCTGTGGAGTTCAACCGCCTCATGATTGTGGA
GCAGCTTCGTTGCGCCGGTGTGATTGCTGCTATCCGCATCAGTCGTGCGGCCTTCCCCAACCGCCTTCCTCTTGTGGAGTTCCAACAGCGTTTCCAGATT
ATTTGCCCGTCTGCACTGCGC