Description :
From Genome Similarity Track
Location :
Scaffold_197:48168- 49694
Transcript NameFunction/comments
Phypl_g5115calcineurin-like phosphoesterase, putative

Sequence
1526 bases(100 bases per row)
CACATTCACTCGATGATCGTGATCCGCCCCTCGTGCTCTGGATATTCCAGCAACCGCTTCTTCATCATGAAGTCGGCCACGACCTCGGGGATCTTCGCGG
CCTCACGCAAGATTTCGCCCTTAAGCCAGGACGAGCacccgtcgccgccaccagcgacaaACTTGGATGTGcccacgaggagctccgtCTCCAAGTCCAC
CGACTCGCCGTTGTCGTGCAGCATCTTCGTGACAGCTGGCGGAGTTGCCTGCATGTCGATAGTCAGCTTCAGTCCCGACACGTGCGGATGTGAGCCGCTC
TGTTGCGGGTACTTGTACAAATGCTGGATGAACGCATCGCGCAGGTCGTTGGCTTTGATTCGGACAAGAACTGCAGGTCGCGGGAACGGCATCTCGTGCT
TCAGGATCCCCACTGTAATGCTGGACTTCGCGGAGTACTCCTTGTCTCCGCGGATAAAACCTCCGTTAATGAAGCCCACATCAGCTACCAGCTCGCTccg
cagcgcgtccgccaCCAAGTTGCCTGAATTGCTTTCTCCTGCTCGTAAAAGTGCAGTCCGCGTAGATAGTGTGGTTGCCAACGTAGCTAACACACGCTCA
TTCTTTTCGGGGTCGTCCTCACTCGCCATTTGTTGCATGTACTTGTAGATAATTTGTTGGCAcgctggctgcggcggcaaGTACGCGTTTGCAATCATGC
TCCACTGCGGCAAGACAGTTAATCCGCGCTCAGGGTGGTCAGCCGAGCGCTTCAGCTCAAACTCGAGCTTGGCCAACCAAAAAGCATTCTGTCCCGACTT
GTGGATGAATGTCTTGCCCTCATACATCGTAAATGGCTCGTGATCATGGCCGCCAAGCACCAAGTCGATACCAGGCACTTGACGGGCAAGCTTCTTATCC
TGCGAAATCGACAGATGTGTAAGCGCCAAGATGAAATCAGCACCTTGGGCTTTTAGCTGGTCAACGCATCGCCGCGACGTGGAAAACACATTGTCAAATT
TCACGCTAGCACCAGGAAACGACAACGTCGGTGTCTCCTCCGTGCAGACACCAAATACTCCAAGCTTCAGCCCGTCCTTCAGTGGGATAATCTCCGTATC
CAAGACCCTATCGAACAGCGCACCTGATGCAGCGTCCAGCACATTGGAGCCGAACCATTTCGCCGTCGACTCGCGCATACGGGCCTTGAGTTCATCGGCA
CCGAAGTCGAACTCGTGGTTTCCCAGCACCACGTACTCGACACCCAGGTGGTTCATCAGCTCGATCATGTGGGCGCTGCAACACGTCGAACAACAGCATT
AGTTTACCCAAACGTTACTCCGCCAATTGCGCTCGCCACTCAACGCACCCTTTGAAGCGCTCGCCCATTTCGGAGCCGGAGAGAAAGTCTCCATTGAGcg
tgaccagcagcgtcacgtcgTCCGGCAGCGCGGCCttctgccgctgcagcagcgtcgcgaacTCTGCAATGCCCCCGTGTCCGTGCTCGTTGGGAGCCAC
GTCGTACACGTCGTTGACTGAGAGGA