Description :
From Genome Similarity Track
Location :
Scaffold_98:48160- 49823
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18985hypothetical protein
Phypa_INRA-310PPTG_18986SF-assemblin

Sequence
1663 bases(100 bases per row)
AGTTCATCTTTCTCACGGGGGCCGATTTTCTGTAGCATCGTTTTCAAGTCAGGCAATACAATGTCATCATCTCGCTGGGAGTTGTTGTCTTGCTCTTGAT
GCTGGTTTTTCTCACGTTGCCACAGGTTACGCAGTTGGGTAGCGAGATCGTTGGTTGAAGCCGCCGATATTGGAATTTCTACACTTGCACTGGTATCATC
GCTTGGTGTTTCTTCGGATTCGTCTGTACCCTGTTGGACTGTCCTGGCTTGAAGAGCAGTGTGGGCTTCCATTGCTCGCTGCAGACGGAGAGTAGCTGGG
ACCTGTTTGCGAGACAACGAACGAAGAACGAAAACATTCACCATGTTACAAGTCTCGTGTTGTTGGCGATGGTGAGTAAACTTACTGGCTGCCGTTCACC
AGAACCATTACTACCGCTGAACGACGAGGAGCGCGAGTGTGCTGGCATTGCTCTTCTCGACGGTGAACAGAACTATGAATGAAAAGTCGCAACCATTTTG
ATAACGACTTTCTGTGAATATTGGAGAACTTAGCACTTTGCACCTTGCTTGTACTGTTGGCAGGTTATACACGCGTGCCACGCAACAAAAGATTCATTTA
TCTGGGTATCCCACTGAATGGAGTAAGGCCACTTTCAACCTTGGTGTCCAATAAGCAACTTTCTTGTGTTTGTCGAGGTACATGTAAGTTGTACCGTACA
ACTTGCAATCATCCTCTGAATCTTTGGCAATTTGCAATGCAATCGAATTCGAGCCCGCTCGCAATTCTATCAGCGATTGTGGAGCCTGTAAATTGGAGTC
GAAGCAAAATCGTCAAGGTGACCTGTGGCGTGATTCTATCATGAAGCGTCGCTATCAGTTGGCATTTGGCTGTCATGAACCAAAGCGAAGAACTAAAGGG
AAGGGCCAAGTCTGCAAGCGAGTTAAGGGAGGAAGATGTTTTAGCTACGACGCAGATCGGTATGACGGCGACGCGCAGCAAACTTGAAAAGCTCATGAGC
AGCTTCACGACGTTCGACGACGTCATGCGCATTGGAACGCGGGTACATTCTGTCGAAGGAAGCAAAGTTGTGAAGTATAGCTAACTGAGCATTTTGTGTC
TACTTCCTTAGCAACGTCGCGAGAAAGATGAGTACCGCTTAGCGGAAATGCGGCAGGAAATGAATCGCCTAGAGAATAAACTCGAGGCGGAGATCAAGAA
GCGGATTGAGATGAACAAGTCGCTGCAGAATTACTGTGACGAGCAGGTGGTTCAAATGACTGCGTCCTTTGAGAAATTGCTAAGCGATCGCGCAAAACAA
GTCGATGATCGACTCGACATTCTCACTCATGAAATAGAAAACCTTCAGGCACTTGTAGCCAAAGAAAAACACGATATCCCGCTTATGATCGAAAACAAGA
CCAATGAGCTGACGCAGAAGCTTATCGCGTTCATGGATTCGTTCGAGGATGAACGCCAGCGGCGCACAAACCAGGAAGCAATGATTCTGAAGCGCTTGAG
TGATCACGAGCATGCAACTGCTGAAAGTTTCGAGCGTGAGCGGGTAAAGCAAGATTTAGCTGGTGTAAGAATTCGGTGCTAATTATCCTTTTCGATCATA
TCATAGCGTGATCGTGAATTGAAGTATTCCGATCTGAAGAACGCGCTGGACACGTACAGCTCT