Description :
From Genome Similarity Track
Location :
Scaffold_163:4816- 8395
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.14Phospholipid-transporting ATPase

Sequence
3579 bases(100 bases per row)
GAGTGGCTCCAAGGCATCGAACAACCAGCAAGTCAAGAGCGAGTACCGCATCGTGCACGTCAGCGATGCCGCGCGCAACACGGAGCTCGGGTACNNNNNN
NNNNNNNGCGACAATTTCATCATCACGTCCAAGTACACGGTCATCTCGTTCCTCCCCAAGTTCCTCTTCGAGAGCTTCCGCAAGCTCGCCAACTTGTACT
TTCTTGCGATCTGCATCATGCAGTGCATCCCACAGATCAGCAACACGAGTGGCCAGCCGTCGACGCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGTGTTTGCCATCCTGGAAGACCGAAAGCGCCATATCGCAGACCAGATCGCCAACTCGCGCCCCACGTATGTACTGGACGCGTCGACCAAGCAATTTGGC
TCGAAAAGCTGGGCGAATATCGTCGTCGGCGACGTCATTCGACTCAACAACCGCGACCTCGTACCGGCAGACATCCTCGTGCTCGCTGTGAGTGAACTCC
CAGATGCACCGCCGTCGGGGATCTGCTACGTCGAGACCAAATCCCTCGACGGCGAGACCAACATGAAGGTGCGTTCGGCGATGGAGTGCACGCTGGCTGA
GATGGGCAGCATCGACAACATCCTTCGAGCCAAAGGCGTAGTCCGGTGCGAGCAACCGAACAATGCGATTAACAGCTTCCAAGGAGTGTTGGAGCTCGAG
GGCAAAGAGAAGCAATCGATCCCGTACGAAAGCATCATTCTCCGTGGTTGCATCATTCGGAACACGGACTGGGTTCACGGGATTGTCTTGAACACGGGCA
AAGACACCAAAATCATGATGAGCAATTCCGCGCCACCATCCAAGATGAGCACCATGGACCAGTCGATCAACAACTATATCGTCGCATTGCTTGTCATCTT
GATCCTCTTCAGCGCCGTCGGAGCCACGGGCGCCGTCATCTGGAAAAGCACGAACAAGAAACCGTGGTATTTGGCCCTCGATGACTCCGGAAATAGTGCC
GGAGTGGACTGGATCATCATGTTATTTTACTACATGCTGCTTATGTACCAGTTCGTGCCGATCTCGCTTTGTGTGTCGATGAGCATGGTCAAGTATTTGC
AGGCGCAGTTCATCCAATGGGACAAACAGATATACCACGATACGACCGACACACCGACTCTTGTCCGCTCAATGTCACTAAATGAAGAGTTGGGGCAAAT
CTCGTACGTGTTTTCCGACAAAACGGGGACGTTGACGTGCAACATAATGGAGTTCCGAAAATGCTCCATCGGGGGGGTGTCGTACGGCAAAGGCACGACT
GAAATCGGACTGGCGGCAATGAAACGATCTGGGAAGCCAATACCGGAATCATCGACATCACAGCAGTCGGCGAAACCAGTTCCATATGTGAATTTCGACG
GCCCAGAGCTATTTGCTGATATGAAAGGCACCTCAGGATCGAATCAACAACGCCGTATCAATGCGTTCTTCACGCATTTAGCTATCTGCCACACCGTGAT
TCCGGAGCGACGCGAAAACTCGACCGAAGTCATCCTGTCTGCGTCATCTCCAGATGAGCAAGCGTTGGTTGCTGGGGCTGGCTTCTTCGGGTTTGAATTC
ATGAACCGCTCGCCTGGGATCGCGCACGCAAAGATTCAGGGCGTGAACCAGCAATTCGAATTGCTCGATGTCTTGGAGTTCAATAGCACCCGGAAGCGAA
TGACCATAATCGTACGGCACCCTGATGGAAAAGTATGCTTGTATACAAAAGGAGCGGACGCCATCATTTTTGCACGCATGGCAAAAACCAAAGACAACGA
GGCATCTCAATTGCAAGAGGTCACACGCCGTCACATCGACGCATACGCAGAGGAAGGGCTTCGCACTCTGACGATCGCGATCCGAGAACTCGATCCAGCA
TATTACGAAGCGTGGGCACGCCGATTTCATGAAGCCCAAAATAACTTGGAAGAGATCGATAAACGGAAAAAGGATCTGCCCAATGCCATCGACGAGTGCA
TGGATGAAGTTGAAAGTGAACTGGAGCTTCTTGGCGCCACGGCAATCGAGGATAAGCTTCAGAGTGGTGTCCCGGACACCATCGCGAACTTAGCGAGTGC
TGGCGTCAAAATCTGGGTTCTTACGGGCGACAAGGAGGAAACAGCGATCAACATTGGCTTTGCGTGCCAGTTGCTGACCAATGACATGACGGTCCTTGTG
ATCAGTGCAAAGCATTTTCCAACCCCAGAGCTCATTGAAGCAGAACTCTTGTCGCAGATAACAGCCCGCGCTGCAGAAGTACACACGTACTTTGCTTCTC
CAATGACGAGCCGAGGGGAGTTAAAGAGCATCGCTCTGGTCATTGACGGTGAAACCCTGATTCATGCACTGACAGGAGCGTGTCGTCCCCTTCTAGCTGA
ATTCTCACAGTACTGCAAGGCTGTCATTGCATGCCGCGTGTCGCCGGCGCAGAAAGCTCAAATGGTTGCGCTCATCAAGGAATACGTTCCGGGTGTTCGC
ACGCTCGCAATTGGAGACGGCGCGAATGATGTGTCGATGATCCAGGAAGCCCATATTGGCGTGGGGATCTCCGGCCAAGAAGGAATGCAGGCAGTCAATT
CCAGCGACTACGCGATCGCCCAATTCCGTTTCCTTGAGCGCTTGCTCTTGGTGCATGGCCGTTGGAACTACCGACGCATGTCACAACTCGTCGTGTACAT
GTTTTACAAAAACATTTTGTTCACGGCAGCGCAATACTGGTACACGCTCCTGTGCGGCTTCTCGGGGCAAAAGTTTTTCCTTGAGACAGGTGTGCAGTTG
TACAACATCTGCATGACCTCGGTCCCAATTGTTGCACTCTCCATTTACGACCAAGACGTGAACGATGAGCTTGCGATGAAGTTTCCAAAGCTCTATTACG
TCGGTCCACGAGACGAAGACTTGAACAAAAGCACTTTCTCCCTCTGGGTCATCGGAGCCATTCTCGAGTCGGTGATCCTGACGCTGTTTGTTCTCAATGG
TATGGAAAACGGTGGCTTCCACGGCGGAACCAGCTCCATGTGGCTCGACGGCAATATCATTTTCACGCTCGTCGTGCTGATAGCGAATGTAAAGCTGATG
CTGTACCAAAACAGCTTCCATATATTCAATCATGTGCTGTACTGGGGGTCGTTCTTCATCTGGCTGCTCGTTGCGTTTGTCGCTGGCGAGGTTTCCATGT
TGTCGGACCTCACGTGGGAGCTGATGCTGCAGCAAATGTTCAAGACCAACGCGTTCTGGGTGCTCCTGCTATTCATTCCAGTTGCCACGCTTTCCTACAC
ATACTTGATCAATGGCCTGAAGCTGACGTTCATGCCCGAGTACTGGCAACTCGCAAAGGAAGTGATCAAATTCAATCTCAGCAAAGATCTCCTGCAATGG
GACGACAACACGAACGCATCGGTGCCAGTCCCCGCCAAACTGAAGCAAGACAAGCACGCGGGACGAGTCGGGCTCGTTGTCCCTACCAACGGCAAGCAAG
CGCACAAAAAGACGCCGTTGGAGCGCGTCTACCACGGGTTCGCATTCTCAACGGACTCGCACGCTGGAGCTGCCGAAGC