Description :
From Genome Similarity Track
Location :
Scaffold_38:4814- 7225
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_38-fgenesh-gene-0.0Splicing factor 3B subunit 5
Pytap_DAOMBR444maker-pag1_scaffold_38-snap-gene-0.53Conserved gene of unknown function

Sequence
2411 bases(100 bases per row)
GAGCTCGAATCATCAGTCAGCTCATCGCTCAGATGGTTGTTCGGCTGGTCCATGGAGCAGCGGCTCGTTTTtCTCGCAGACTTTTCGGCCATGGTCCGCC
TTTGGTCGCAACTCTGATCTGCACCCTTCTCAAAAACCGaGACCACGGCTGGTCTGTCAGCTGCGGgCGCCAAAAAAACCAaCAAGATGCTAGTTCGAGC
CAGCCCTGTGCACTGGAAGAATGGATGCTGGCGGCTGAGCCAGCGTGTACCGCCATGAGAGCTCCGTACACTTGCGCTGCGCAAATTGCGTACAGTGTAC
GAAGTCTTTCCGGCGGGAGTACCTCGCACTCGTCACAGAGGCCACCAAGCTGTGCCTGTTGTTtAATGCTACAGTGGATTGAAGGGACCGCCGACGAGGT
CCACGCGCTTTCTTACTGTATGGACTCAGTCGGAACTGCCGGCAGTTTTCGCCATTGAATGCGCCCGCCAATCCCATGGgAAGGTCTTCGACAAGAGGTG
AGTCGTGTTCCCTAAAAAGCCCATTTTCAGCAAGGAGGAGCCTCTGGGGCACGCCGAGCCCCCTCCATAAATCGATAATCTtGCGGTTtCAAATCATGTA
CATCACaGATTTTCCCTGGGCGCTGGTTAGGTGTCCTGTCAGATCTAATGATCCGGTCGGAACGGaCTGGTGAAATTGAATAAGGATAAAACGTGCCATT
tGCACAATCTCGGATAGTTTCGCCCAAGTAGATCATGTTTATCTGGTCAAAaTGATGTCTCGTCACCAGCCATTATCGTCCAATCAGCGAGGAACTGGTG
TTGGCATGACCTCGACACCAAGACCAAGGCGAGAAGACGCAGGTGCAACATGGTGCGTGAGTCGGCGCCACGGCGGCgTATGCGGGgAGTACTCATGCGT
GGACTGTAGGCGGCCGATCGCTTCAACATCAACCGCCAGTGGGAGCATCTCCAGGCCAAGTATGTTGGCACAGGCCACGCAGATACGACCAAATTGTACG
TGAGCATGTATTCCCATACCGTGGTCGTAGTCCACTAATGCCGTCACTTCGCAGTGAGTGGGCCGTAAACCaGCACCGCGATACGTTGGCCTCGCACATC
GGCCACTACGACATGCTGAGCTACTTCGCTGTTGCCGAGAATGAAGCCGTTGGCCGCGTGAAGTACAACATGCTGGAGGTACAATCTACTCGTTTCATCG
CTGATTATTtCCATCGCGCTCATGATTCTGTGCTCAATGTAGAAAATGCTCCAGCCCTGTGGACCACCGCCGAGAAAGGAAGATGATTAGTTCTGGGAGT
GCTTGCACACATTGCAAGAACGAATGCAAGCGCGGAGAACACGTCATTCCCCCCCCCCCccGCCcAAaTATCAAGGTTGTTCGTTCATCTTGATTACTCT
TACCTATCTGAACCACGGGTGGATACGAAGTCGGTGGATTTCCAGCTGGACActGCCGAACGTACTGTGCATTGATCGTCTAAAATGATGCGCTCTTGCA
TGCTTACAACACCGTGGAGCTgaTTCAGCAGGTTCATTTTTCTTtGCAGTAAATCAGTCTCGGACATCTGCAGCAAAGGAGATGTCAGCCCCAACATTTG
ATCGAAAGGTTCAAGCATCACGTACAGATTTCAAAGTCTCGGCGTTCAATGTTGGCAATGATTGACCACGATGCAACCGCATGTAGTCGAACTTTCGAAT
TACGTTCTTTTGGAAAGCAAGCATCTGTGAAGCTGTCGGACCCTAGTCAGTTATCGAAAGCACTACTTGTCGACAGATAAGAACTTACTGTCAGAGCCAG
ACGATAGCAGTGGCGCAGGGGTTGACAGACGGTCAAGCGTTGCCTTGCTGATCTTGGTCTTCTGCTTGGCCTTTTCAACTGAAAAGGAAACGCTGGGCTC
AGCGAGTGACGGCTCGCTACTAACCGAGGCTGTTGTCGTCGAAAGGTTTGTGGGAGTCAATGCGCTCCCTGGAACTCCATGTGCCTTCCACTCAGCAACC
TTGGCCTGTAGAATAAGCTGGTGGTCTTCTTGGATCTGCAACATTCTTTCCTTGTCCTTTGCCCGTTCTTTTTCAAACTGCTTCTCAAGTCGTTTGCATT
CCTCTCGCGATCCCGCCTTTTCCAGCTTCCTCTTGCGCTGCCTCTCGCTCTCAATAGCGTCTTTCACCCACTGCACATAGTATTCTTGCTGTCTAACTCG
CAGcAAACGCGTGGCCTTGTCAATATCTGCACTTGAACTCGCCATCTACTCCACCCCTCCTTCCATTTCCATCAGCGTCGAGTGGAGCCAAATTTAACTT
AACGGTATACTACCCCCTGAGATTCTATTCCAAAAACCGCACTTACGAGTGATGGTCATTATTTCGCCAGCAACTCGAGACGACGCAATCACTTGGGAGC
TCCATTCGTCC