Description :
From Genome Similarity Track
Location :
contig_42:481363- 483443
Transcript NameFunction/comments
g9118.t1hypothetical protein

Sequence
2080 bases(100 bases per row)
TGTGCCAGAGCTTCATCACCCTAACGACTATCAATCTTTCTCCTGGTCTGTTGTTGAGGAATGTCCCTGGGCTGCGTGGAGGTGACAGCCTTCTTGGGGG
TACCGCACGACTTCTTCGAACTCCCCCCCGACGCCAGCTTCTCCTTCCACTCCCCACTTCCAATCTTCGCCTTCCGTTGGGGGATATCCTTGGGTCGTGT
TGAGCTGCCTTCTTTTCGTGGGGTGTCATTCATCCTCTTTGAGGAAGGCGCTTTCGTGGGGGTGACAAACTCCTTTGGCTCGGTCCGCTCTTCGCTATCA
CGCTTCGCTTGCCGTCGGGGGAAATCAGTGGGTTGCATGGTGCTTACCGTCTTCTTCTTGATGGTCAACCTCTCAGGGCTGCCCTCGTTCGTAGTGGTCG
ATTTCGCGGTGGTTTTCTCCTTCTTGTCCTCAGCCGCAAGCTTCGTGGCCTCTTCGAGTCGGGTAGCCCACATCGTGCGATTCCGCTCCACATTGGCGAG
GCAGCCTTCTAATCCAGCCAACATGCCTCCGAGCGCACGCCACAGAGGGAACGCGCACGAGTCGACAAACGCCAAGTTAACACGCGCAAATTCAGCCGAT
CCGGGCGAGCATCCATGAAAGCCGTCGCTGAAATCCCCAGCTCAACCTCCTCTGCATGCTGCTCATTGAATTCTTCTAGCAGCCTCGTCGTCCAGCGGAA
GTGCTGCTCACAGGACTGAGTCGGGCCCGAGAGGTCTGCCGAGTGCACAACAGCACTCACTAGCAGTTCACGCAGGGCCTCGTCATCGTTCCGGCTCCCA
CGGACTTGAGCTTCGTGTACTTGGCTACAATGCTAGCGTGGCGATGCATATCAGTGGCAAGAATCGCGCGGATAATGCGCTTGCGAACCGCACGACGGCT
TCCAACAGTGTCACTCGAGCCATCCTCCAAGCCAGCCAGCACATCATTGCCAGGTCGGCGCATGGTCTCGAAGCATGCAGCTGAGTGCATGTTTTCCAGC
ACGGAGTGATCGTTATAACGACGAGCGAGGCGCGAGCTGCACCTCACGTGAAAGTCGTTGGTTCTGGCGTCGTGGCCCATGTCGTGACAGAAAGCTGCCA
CGAACACTGCAAGTCGCTCTCGAGGAGCAAGTATCAGTTCGCCGCAACGTTTCTGTCGGCTCCGCTCTGTGGCCTGCGCCTTCGTGGTCGGACTCACTCC
GAGCGCAGTGGAAGCGGGAATCAGTGACGAAGCCAGCTTTTTGCTCTGCGCAGTGAGCATGAGGAACGTCGTGTGCAGCGTGGCGAAGGCATGGTACGTG
TTGTGATACGGCACGTCAAGGTACTGGGCCTGTACGCTGTGCAGGAAGCGGCGTAGCGTGGCTTCCGGCAGTGCGAATCCATCCATGAGGTCGTGCAGCT
CGAACATGTCCACTGCGAGGTCAATGAGCTGAGCCGGCGAGAACTGCCACGGATCCAGGTCCCATTGTAGGGCCGGGCTTTGCGTGCCTTGACTTGATGC
AAGGCCAATGCTACCGGGAAGCGAGGCGAGCATTCCACATCCGCCGCTACTACTCAAGAAGCAGCGTTCGTGGTACGAAGTGGCAGCTACGACTGCTGCA
GCGTGGTCATGATCACTCACGACGGATGGAAGGCGTGAACGCGGACGACGACGACGGCGTACGGGAGACGCCGTCGTGTACTGTGACAGGAACGTCCGTG
TCACGTGGCTCTCGCCTTCGCTGTCGCTGCTTTCGCTGTCGTCATACGACGGCGACTCGAACACAAGCTCCCAGGCACGACGCTCCACAAGAGCCGAGAG
TTCCACGCAGATAGCACGTAGCACTTGCTCGTCTTCCGCGTCAAAGCCCTCGGTCTCGCCGCTGGCGCTCATTTTGTTAACTGCGTAGAACACGCCGATA
ACGGGGCGATCGTCGCCGTCTTCGTCGGTACTGCTGCTCGTACTGAAGCTGCTGCTGCAGCGACGTCCAGACCTCCCAGAAGCGCCTGAAGATGCGAACG
GTGCAGTAGACGACGAAGCTGACATAGATGGCTGAGCCTTGATGGGCACACACAGCAGACTCGACGACTGCATACCCATC