Description :
From Genome Similarity Track
Location :
contig_42:481309- 483389
Transcript NameFunction/comments
g9560.t1hypothetical protein

Sequence
2080 bases(100 bases per row)
CCTTTAACTCTTTTCACTTGATTGCTGCAACACAAACACTTTTGTCAAAACTTGGTCTTTGTTTATGATACAACAGCAATAGATAAGGTTGGCGATGTGA
GCTGTGCCAGAGCTTCATCACCCTAACGACTATCAATCTTTCTCCTGGTCTGTTGTTGAGGAATGTCCCTGGGCTGCGTGGAGGTGACAGCCTTCTTGGG
GGTACCGCACGACTTCTTCGAACTCCCCCCCGACGCCAGCTTCTCCTTCCACTCCCCACTTCCAATCTTCGCCTTCCGTTGGGGGGTATCCTTGGGTCGT
GTTGAGCTGCCTTCTTTTCGTGGGGTGTCATTCATCCTCTTTGAGGAAGGCGCTTTCGTGGGGGTGACAAACTCCTTTGGCTCGGTCCGCTCTTCGCTAT
CACGCTTCGCTTGCCGTCGGGGGAAATCAGTGGGTTGCGCGGTGCTTACCGTCTTCTTCTTGATGGTCAACCTCTCAGGGCTGCCCTCGTTCGTAGTGGT
CGATTTCGCGGTGGTTTTCTCCTTCTTGTCCTCAGCCGCAAGCTTCGTGGCCTCTTCGAGTCGGGTAGCCCACATCGTGCGATTCCGCTCCACATTGGCG
AGGCAGCCTTCTAATCCAGCCAACATGCCTCCGAGCGCACGCCACAGCGGGAACGCGCACGAGTCGACAAACGCCAAGTTAACACGCGCAAATTCAGCCG
ATCCGGGCGAGCATCCATGAAAGCCGTCGCTGAAATCCCCAGCTCAACCTCCTCTGCATGCTGCTCATTGAATTCTTCTAGCAGCCTCGTAGTCCAGCGG
AAGTGCTGCTCACAGGACTGAGTCGGGCCCGAGAGGTCTGCCGAGTGCACAACAGCACTCACTAGCAGTTCACGCAGGGCCTCGTCATCGTTCCGGCTCC
CACGGACTTGAGCTTCGTGTACTTGGCTACAATGCTAGCGTGGCGATGCATATCAGTGGCAAGAATCGCGCGGATAATGCGCTTGCGAACCGCACGACGG
CTTCCAACAGTGTCACTCGAGCCATCCTCCAAGCCAGCCAGCACATCATTGCCAGGTCGGCGCATGGTCTCGAAGCATGCAGCTGAGTGCATGTTTTCCA
GCACGGAGTGATCGTTATAACGACGAGCGAGGCGCGAGCTGCACCTCACGTGAAAGTCGTTGGTTCTGGCGTCGTGGCCCATGTCGTGACAGAAAGCTGC
CACGAACACTGCAAGTCGCTCTCGAGGAGCAAGTATCAGTTCGCCGCAACGTTTCTGTCGGCTCCGCTCTGTGGCCTGCGCCTTCGTGGTCGGACTCACT
CCGAGCGCAGTGGAAGCGGGAATCAGTGACGAAGCCAGCTTTTTGCTCTGCGCAGTGAGCATGAGGAACGTCGTGTGCAGCGTGGCGAAGGCATGGTACG
TGTTGTGATACGGCACGTCAAGGTACTGGGCCTGTACGCTGTGCAGGAAGCGGCGTAGCGTGGCTTCCGGCAGTGCGAATCCATCCATGAGGTCGTGCAG
CTCGAACATGTCCACTGCGAGGTCAATGAGCTGAGCCGGCGAGAACTGCCACGGATCCAGGTCCCATTGTAGGGCCGGGCTTTGCGTGCCTTGACTTGAT
GCAAGGCCAATGCTACCGGGAAGCGAGGCGAGCATTCCACATCCACCGCTACTACTCAAGAAGCAGCGTTCGTGGTACGAAGTGGCAGCTACGACTGCTG
CAGCGTGGTCATGATCACTCACGACGGATGGAAGGCGTGAACGCGGACGACGACGACGGCGTACGGGAGACGCCGTCGTGTACTGTGACAGGAACGTCCG
TGTCACGTGGCTCTCGCCTTCGCTGTCGCTGCTTTCGCTGTCGTCATACGACGGCGACTCGAACACAAGCTCCCAGGCACGACGCTCCACAAGAGCCGAG
AGTTCCACGCAGATAGCACGTAGCACTTGCTCGTCTTCCGCGTCAAAGCCCTCGGTCTCGCCGCTGGCGCTCATTTTGTTAACTGCGTAGAACACGCCGA
TAACGGGGCGATCGTCGCCGTCTTCGTCGGTACTGCTGCTCGTACTGAAGCTGCTGCTGCAGCGACGTCCAGACCTCCCA