Description :
From Genome Similarity Track
Location :
Scaffold_315:4813- 9947
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_315-fgenesh-gene-0.2ATP-binding Cassette (ABC) Superfamily

Sequence
5134 bases(100 bases per row)
GCGCTCGAGGCGCGACTCACCGCTGCCTCGGCGTCGCGATGGAGCTCGCTGATACAGGCGTGGCGGCAGATCACCAACCTCGTGTGGAAGAACCTGTTGA
TCCGCCAGCGCAAGCCAATCGCGCTCGTAATCGAGCAGTTCTTGCCGGTGCTGCTCTCGTCCGGACTCGTGCTCCTCGCCAACCTCGAGACGCTCTTCGG
CTCGTCCAACCCGTCGAAATCGCGCACGCTCGAGGCCACGACGAACACCACAACTATCTTCTGCATGAACTACACCGTGACGGACGTGGCCGACTTGGGC
GGCCCCAACTCGACCATGTCGTCCTTCTATTCGAGCGGTCAGGCCGTGCTCGGCATGTTCTTCCTCGTAAGCTACATCAAGTTCGTCTCGTCGACGACCA
CAACGATGGTGATCGAGAAGGAGAACCGCATCCGCGAGATCATGAAGATCATGGGGCTCTCGGACTTTACGCTGCTCTGCTCGTGGTACCTCACGAGCGC
CATCCTCTCGACGCCGCTTGCCTTCACCATCGCGGCCGAGCTCAAGTTCGGCAACGTGTTCCCGACGACCGAGCTCGGCGCGCTCGTGCTGCTCTTCTGG
TCGCTCAGCATGGCCATCGTCGCCTTCAGCTACTTCATGACTCCGTTCTTCCAGAAGTCGCGCACGGCCGCCATCATGTCGGTGCTCTTCTGGCTCATCC
TGTACTTCCCCTTCTACGCCGTGCAGCCCGCGCTCTCCAACAGTGCCAAGTACTGGGCGGCGCTGTCGCCACCCACGGCTTTCGGTCTCGCGATCGACGA
CGTCCTTCGCCACGCACAGCTCGGCACGGGGTTTGCCTATTCGCTCGGGAGCCAACAGGGAACCATCGACGTTCCCAGCTCCACCTCCATGAGTCTGATG
CTGCTCTTCGACGCCGTCTTGCTGGCGTGCGCTGGCTGGTACTTGGAGCAGGTGCTGCCTCAAAAGTACGGCCTGCGCAAGCCTTGGAACTTCCTCTTCG
TGCGAACACGGTCTCCGGATATGAATCTGCCACGACACTCAGCGCCAGCACGGCGACCCAGCAACGCCATCGCTCGAGCTGTCAAGGCGGTGCTACGAGT
GAGGTCGCTGAAAGCAGGCTTTCGCCTCGCCAGCAGCGTCCTCGTCGGAGGGAACTCGGCAGCCGAAGCGCGGGAAGATGGCGTGGAGAAGGCGCCAGTC
CACGAGACCCAGAAACAACACGAGGACGAGTGCAGCGACAGCTTCGTCGAGCCGGTGTCGTCGTCGCTGGCGCTGCAGGAGACCCGCGGCGAGTGTCTGA
GCATCCGCGGCCTACGGAAGACATTCCAGACCGACGACGGCGAGAAGGTGGCGGTCGCCGGGTTGGACTTGACGCTCTACAGCGGACAGATCACGGCGCT
GCTGGGCCACAACGGCGCGGGCAAGACGACCGTCATCTCGATGCTCACGGGTCTACTACCGCCGACGGCCGGCGACGCGACCATGTTTGGGAGATCAACG
CGACGCGACTTTGATGCGCTGCGCCGCATCATCGGCATCTGTCCGCAGCACGACGTGCTCTTCAACGAGCTGACGGTCGAGGAGCACTTGCAGCTGTTCG
GCACCATGAAGCATGTGACGCCTGACCAGCTCAGCGCCGAAGTCAACAAGATGATCGATCTCGTGGGACTCACCGAGGTGCGCGGCGCGCTGTCGCAGAG
CCTGTCGGGCGGCCAGAAGCGCAAGCTGAGCGTGGCGCTCGCCTTCATCGGCGACAGCAAGCTCGTCTTCCTGGACGAGCCGACGTCGGGGATGGACCCG
TACTCGCGGAGGTTCACGTGGAACCTGCTGCAAAAGAGCCGTGCGGACCGCGTGATCGTGCTCACGACGCACTTCATGGACGAGGCCGACATCCTCGGCG
ACCGCATCGCCATCGTCGCCGACGGCCAGCTGCGCTGTGCGGGCAGCTCGCTCTTCCTCAAGACGCGGTTCGGCACAGGGTATAACCTGACCGTGATCCG
ATCGCCGATAGCGCCGTGTGATCCAGACGCCGTCGCCACCTTCCTTCAAAAGTACGTGCCTGGCGCCACGTGTCTGAGCAACTACGGCTCGGAGCTCGTG
TTCCAATTGCCCATCGTGGCCGACGCGTCCTCGGAGGCACTGCCCGAGATGCTGCAGGCGCTCGACCAGCAGCTGTCGACGCTCGGCTTGCAGCAGTACG
GCATCTCGGTCACGACGCTCGAAGAGGTATTCCTCAGGATCGCTCGCGACCGTGACGACGCCACCGCCGCGTCTACCACGGCCATGGAGAGCACCACGAC
GCTGCCCACGGTCGCCCGCGAGTCGGCTACCGTGGCCGCGACGGCACCACCTTCTCGGTGGCCGGCGGCTTCGTTCTGCCGGCAGCTGGCCGCTTTGATC
CGCAAGCGCGCGCAGATCGGCCGTCGCGACCGCAAGACGATGATCAACTCGGTGGGGATCCCCGTGCTCTTCCTCGCGATCCTCGTGACGCTGCCGCGCA
TCCAAGTGGCGGACTTCATCCCGGACTACGGCAAGATCCTCCCCACCGCTGAGCAACAGCAGATGTGTCCGGCCGAGACGATCACCGACAGTCTGCTCAA
GCCCAAGTCACTCGCGTCGTGCGTTGGGCCAAAGTACTTCCAGTACTGCGAGCTCGGCCTGGTCAAGTGCGACGTGAACCGGTGCTGCAACGCCGCCGAC
TTCACGTCGCCCTGGTACCAGTGCAACAACTGCAAGTCGTGGCCCACGGGTCTGCCGGTCGGCAAGGCGGCTCCGTCGCAGTACCGGTGCTTCAACCGCG
AGTGCCTCAAGAAGACGGATGCCAAGCTGCAGGTGACGCTCAACGCGTTCCTCATCGCCTTCATCGCCATGCTCGCCTTCGCCTTCATCCCGGCGTCCAT
CGTCGCCTTCGTCGTGCGCGAGAAGGACCCGGCGCAGAACGCCAAGTCGTTGCAGCTCATCAGCGGCACGAGCGTCGGCGCCTACTGGCTGTCCAACTGG
ATACACGACGCAGTCGTGACGAGCGTCCCCGTGGCGCTGGCCGTCGCACTCATCCCTCTCTCGTACGAGCCGCTGCGCGGAGGCTCCGAGTCGCTCGCCG
TCGCGCTCATCGTGGTCTCCCACGTGCTGGCGTACATCCCGCTCGCGTACCTGCTGTCGCGCCACTTCACGCGGCACGCCGTGGCGCAGACGACGCTGCT
CGTGTTCGGCGTCGGCGTCAGCGGCCTGCTCAGCATCTTCTCGTTCCTGTGCCGCGTCATCGACTTCCGCTTCTCGCCGGCGCTCACGCTCGCGGCGCTC
GACCGCAACTACCTCCGCTGGCTCTTCCTCGCCGCGCCGGGCTACGCGCTCAACTCGGGCCTCTACGAGATCGCCACGCGCAAGCTCAGCCGCAAGTCCG
TCTACGCGACTGGCAGCTCCACGAACATGACGAGCTCGAACCCACCGTCCTTCTTCGGCTTCTTTGAAGGCCTCTCGTCGCGAGACCCGAACTGCATCGA
CTGCTGGGACAACAACACCATCGGCTGCTGCACGCGCGAGGTGTTCGACGTCGACGTGGCCGGCGCGCCGCTCGCCTACTCGTTCGGCGAGGCGCTGCTG
TTCACGGTCGTGCTCTTCTACCTCGAGCGGCGCGCCGTCGTGTGGAACCGCAGCAAGTGGAGCAACCGTCAGCGACCGAAGCCCGTCGGCAAGGAGGACG
ACGATGTGGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGCCGACCTCGAGCGACCTCGTGGCGATCCGCAACTTGC
ACCACCAGTACAGCGACCGGCGCGCCAAGGTGGCGCTCAAGGACCTGTGTCTGTCCATCCCGGCGGGCGAGTGCTTCGGGTACCTCGGCATCAACGGCGC
CGGCAAGTCCACGACCATGCAGGTGCTCACGGGACTGTTGGCGCCGACGTCGGGCGTGGTGACGCTCGCGGGCCACGACGTCGCGTTCGACATGGCCAAG
GCGAGGCGGGAGCTGGGCTACTGTCCGCAGTTCGACGCGCTCCACGACCTGCTGACGGTCGAGGAGCAGCTCGAGCTATACGCTCGGCTCAAGGGCGTCC
CGGAGCGCGAGGTGCATGCGATGGTGCGCGAGCAAATGGCGCTGGTCGGGCTCATGGAGTACCGCAACAAGCGTACGCGGTCGCTCAGCGGCGGCAACAA
GCGCAAGGTGTCGACGGCGATCGCGCTGCTCGGGTCGCCTCGGCTCATCTTCCTCGACGAGCCGTCCACGGGCGTCGACGCGAGCTCGCGCCGCAAGATG
TGGAACGTGATCGCCGCGGTGGTGGCGCGCCGCGACGCGTGCGTGCTGCTCACGACGCACAGCATGGAGGAGTGCGAGGCGCTGTGCACGCGCGTGGGCA
TCCTCGTGAGCGGCGCGCTCCAGTGCCTCGGCAGCGTCGAGCACCTCAAGCAGAAATTTGGGCGGGGCTACACGGTCGAGATCAAGCTGCGTGAGCCTCC
GCGCGATGCAGTCGAGCGAACGAAGGCACAACTCGCGGTCTTGGCCCTCGCTCGGCGTCCGCGAGCCAGCAGTGTCGACATCACCACGGGCGACGCGCCG
AGTCTCCAGCTCACAGCCGAGGACATTACGGCTCTGGCGGCAGTCGACATAACCGCCGCTGTAGCGAGCAGCGATGATGGCGGACGAGTGGAAAAGACTG
ATCGATCGCTTGACTGTGAGGTGGAGGTGGCGGCAGCGCGGGTCGCCAAGATCTCGAGTGGCGACGGGACGGGATGGCTGCTCACGAGTATGCTGCGGGC
GTTCGGAGTCGTCCCGATCGCCACGTTCGCGGCCTGGTGGGCGGCGGAGGATCAGCGCGACGAGTTGCAGGCGTTCGTGCAGCGCACGTTCGAGGGCACC
GTGCTCGTCGAGCAGCAGGGCGACCTGTTCCGCTTCCAGGTCCCCAAGGAGGTGGTTAGCTCGTCCGGTGAACTGCCATCCAAGCGAAGGAAGCCCCACG
AGGTCTTCCGCGCGCTCGAGCAGGCCAAGGCGCGGCTCAACGTGAGCGAGTACGGCGTGAGCGACACGTCGCTCGAGCACATTTTCAACAACTTTGCCTC
GCAGCAGGAGGAGGAGCGGGGCGAGGCCCACGGC