Description :
From Genome Similarity Track
Location :
contig_42:481100- 482931
Transcript NameFunction/comments
g9118.t1hypothetical protein

Sequence
1831 bases(100 bases per row)
AAGCTGGTTTTGCCATGCAAGCGCTGATGGAAATCCCTGGTACGTGTTGCGTTTGCTTCGATGTGGGTTCGATCATGTTTGACGCAATGTTTACTGCAGA
ACAATACCAGACAATACGGAACTTGGTCTGCTCGAGCTCCACCGGTAGGCGTGGACAAACACCTTTAACTCTTTTCACTTGATTGCTGCAACACAAACAC
TTTTGTCAAAACTTGGTCTTTGTTTATGATACAACAGCAATAGATAAGGTTGGCGATGTGAGCTGTGCCAGAGCTTCATCACCCTAACGACTATCAATCT
TTCTCCTGGTCTGTTGTTGAGGAATGTCCCTGGGCTGCGTGGAGGTGACAGCCTTCTTGGGGGTACCGCACGACTTCTTCGAACTCCCCCCCGACGCCAG
CTTCTCCTTCCACTCCCCACTTCCAATCTTCGCCTTCCGTTGGGGGATATCCTTGGGTCGTGTTGAGCTGCCTTCTTTTCGTGGGGTGTCATTCATCCTC
TTTGAGGAAGGCGCTTTCGTGGGGGTGACAAACTCCTTTGGCTCGGTCCGCTCTTCGCTATCACGCTTCGCTTGCCGTCGGGGGAAATCAGTGGGTTGCA
TGGTGCTTACCGTCTTCTTCTTGATGGTCAACCTCTCAGGGCTGCCCTCGTTCGTAGTGGTCGATTTCGCGGTGGTTTTCTCCTTCTTGTCCTCAGCCGC
AAGCTTCGTGGCCTCTTCGAGTCGGGTAGCCCACATCGTGCGATTCCGCTCCACATTGGCGAGGCAGCCTTCTAATCCAGCCAACATGCCTCCGAGCGCA
CGCCACAGAGGGAACGCGCACGAGTCGACAAACGCCAAGTTAACACGCGCAAATTCAGCCGATCCGGGCGAGCATCCATGAAAGCCGTCGCTGAAATCCC
CAGCTCAACCTCCTCTGCATGCTGCTCATTGAATTCTTCTAGCAGCCTCGTCGTCCAGCGGAAGTGCTGCTCACAGGACTGAGTCGGGCCCGAGAGGTCT
GCCGAGTGCACAACAGCACTCACTAGCAGTTCACGCAGGGCCTCGTCATCGTTCCGGCTCCCACGGACTTGAGCTTCGTGTACTTGGCTACAATGCTAGC
GTGGCGATGCATATCAGTGGCAAGAATCGCGCGGATAATGCGCTTGCGAACCGCACGACGGCTTCCAACAGTGTCACTCGAGCCATCCTCCAAGCCAGCC
AGCACATCATTGCCAGGTCGGCGCATGGTCTCGAAGCATGCAGCTGAGTGCATGTTTTCCAGCACGGAGTGATCGTTATAACGACGAGCGAGGCGCGAGC
TGCACCTCACGTGAAAGTCGTTGGTTCTGGCGTCGTGGCCCATGTCGTGACAGAAAGCTGCCACGAACACTGCAAGTCGCTCTCGAGGAGCAAGTATCAG
TTCGCCGCAACGTTTCTGTCGGCTCCGCTCTGTGGCCTGCGCCTTCGTGGTCGGACTCACTCCGAGCGCAGTGGAAGCGGGAATCAGTGACGAAGCCAGC
TTTTTGCTCTGCGCAGTGAGCATGAGGAACGTCGTGTGCAGCGTGGCGAAGGCATGGTACGTGTTGTGATACGGCACGTCAAGGTACTGGGCCTGTACGC
TGTGCAGGAAGCGGCGTAGCGTGGCTTCCGGCAGTGCGAATCCATCCATGAGGTCGTGCAGCTCGAACATGTCCACTGCGAGGTCAATGAGCTGAGCCGG
CGAGAACTGCCACGGATCCAGGTCCCATTGTAGGGCCGGGCTTTGCGTGCCTTGACTTGATGCAAGGCCAATGCTACCGGGAAGCGAGGCGAGCATTCCA
CATCCGCCGCTACTACTCAAGAAGCAGCGTT