Description :
From Genome Similarity Track
Location :
Scaffold_86:48107- 50285
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.19Haloacid dehalogenase superfamily protein
Pytve_DAOMBR484maker-pve_contig_86-fgenesh-gene-0.9Kinesin K39

Sequence
2178 bases(100 bases per row)
CCAGCTGGCAAGCGAGCACCGACGCCTCTACTCGCTGCAATCGCGCATTGCGTGCCTCGCCGTTCATTGCGATCTTCAATTGCGTGCTTGCTAGTGTTGC
TCACGGTCTCTACTCTATGTGAGGCTTGGTGCGGAGAATGGCCGACTATTGCGGTGGTGTGGCGGTCGAGTCCTCCGGCAAGAGCGGATGCTCCTTGGGT
CGAACCCCAGCGTTCAGCAGCAGGCGCACCATGGCCTTCTCGAAGCGCTGCATCTGGATGTTCAGCACGCTCTCGCCCTCCGTCGTAAACTGGTCCGTCC
GGATCGTCAGCATGCCTGCAAAGACGGCAAGGTCGTAGGGTTTAGACCTCGGTTTGTTCATCTCACGCCGATCGAGCGAACGCACCGTTTAGGTTGCCGA
AGAGCACGTCGGTCGAGTACCGGTCGCCGACCATGACGAGCTTGTCCGTCTCGACGTCAAAGTGTCGGCGAACATACTCGGCCCCGCCCGGTTTCTAATA
CACAATCGGCACATCACAGCATGCGTCAATCTCCACACATTTGATGGGAAAGCAGTGATAATGACTCGAACCTTCTGGTTGTGACGGAGCACGGCGACCT
GCAGCCCAGTCTCGATCTCTTTCGCTTCGACGAAGTCCGGGTCGTCGTTCGATCCCGCCGAGTTGGAGAAGATGACGACGCGGTCGCCAAACACGCGCTT
GCACTCGTCGAACGCAGCCTGTTTCGTTGGTACAATAGTGGGTTATCACATGAGGAAATGACGTCTTCCAAGGCAAAAGAGCGACCAACCTGCAGGTGAG
CCGGCACCTTGTGGCTGTACGGCACTGTCAGCGTGTTGTCCTTGTCGAAGACGACGCCCTGGAAGCCCCGGTCCTTGAGCGTCTGGAACTGCACCTCGTT
CAAGTCTGCGCATCACTCGGCCAATCACTCAGCTGCCGCCACAATTATCGCACTACCAGCAGCAAAACCAGCACGCAGCGCACTGCATAGTACTGGCTCT
CACCTCGCACGGATACCTGCGGCAGCAGCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCAGAATTCGGTCACGCCCCGCAGGT
TCAGGCCTTTCATCGCGATGATGTGCGGAGGTGTCCGCTTTGCCGGCAGCAAAAACAGCATTTCATCATATTTTCACCCAATCAAGTACGTCTTTAACCG
AATTGATGGGCATCGATTGGCCAGAGAGATGTTATTTTCAGCGAATCCGCGGGCCGCGTCACTATATGCGGCGTAGAAACCGCAGTCGCAGTTCGGAGAC
CGGGCGAGCATCACTCTCGCGCAAGGGAAACCCGCCGTCACTGCGCGCTCTCCTCGCCCCCGCGCCGCCCTCCGTCCCTCCCTCCGGTATGTCGCTCGAC
CCGCGCTTCCCCTTCCTCCCCTCGCTCTCTATGTGTCTCGGCCGGCTCCGACCGCAGGACATGTATTCTAATGGCGTTGCGTGGTCGTGTTGTTGGCTCG
GCAGCGTCTTATCCTCTCGATTAATCTACCGGCCAAGACTCGCGGAGCTCGAGGCCGGCTGGAGGTTCCTGGTGAGCAGAGCGGAGGTTGTCTGTGGAAG
ATAGCGCGGTCGACGGGTTCGTTATCTCTCGAGTCGACTTAGCGAGGTTGTGAGAGCCATGAGTGACGATGAAGAAGTCAAACGCGGCGGACTAAACGGC
CAGGAGGACGCCGAGAAGGACGGCGCGAAGAACTCGAGCTCCGATGACGACGACTCATCCTCGTCCTCGAGCTCCGGGTCGTCGTCCGACTCGTCGTCGT
CCGACTCGGAGTCGGATGGCGAGGACAACGAGGAGAAGAGCAAGGAGAACGCCTCGGAGACTCCCGGCGAAGGCAACCAAGCGTTCGGCCAGGACGGGCT
GCACTACTCGGCGACGGCGGCCGCGCGGAAGCACAGCTCGGATGGGCAGAGCCACGCACACGGGTTCAGCAAGAGCGCGTTGGCCCAAGCCACGGCTGCA
GAGATGAACGTGAACTCGAACCGAGCGGCTGCGCGGTTCCGGGAGCAGAACCCGGCGCAAGCGATGGGGATGATGGCGCTCGGCACCAAGAAGCGGGACC
GCCGCACGATCGAAGAGATCCAGCGCGATCTGCAGCTCAAGCGCGGTAAGAAGCCGACGGGTTCTGGGCTGTCAGGTG