Description :
From Genome Similarity Track
Location :
contig_42:481046- 482877
Transcript NameFunction/comments
g9559.t1hypothetical protein
g9560.t1hypothetical protein

Sequence
1831 bases(100 bases per row)
AGATAATGGAAGAGTTCGATGACCAGCTTCCAGCTCGCCAATTTGATAACTTTCAGTTCGTCGAGTACAATAAAGTGCTCAAGCGCAACCTGAAAAACCC
GGAAGCTGGTTTTGCCATGCAAGCGCTGATGGAAATCCCTGGTACGTGTTGCGTTTGCTTCGATGTGGGTTCGATCATGTTTGACGCAATGTTTACTGCA
GAACAATACCAGACAATACGGAACTTGGTCTGCTCGAGCTCCACCGGTAGGCGTGGACAAACACCTTTAACTCTTTTCACTTGATTGCTGCAACACAAAC
ACTTTTGTCAAAACTTGGTCTTTGTTTATGATACAACAGCAATAGATAAGGTTGGCGATGTGAGCTGTGCCAGAGCTTCATCACCCTAACGACTATCAAT
CTTTCTCCTGGTCTGTTGTTGAGGAATGTCCCTGGGCTGCGTGGAGGTGACAGCCTTCTTGGGGGTACCGCACGACTTCTTCGAACTCCCCCCCGACGCC
AGCTTCTCCTTCCACTCCCCACTTCCAATCTTCGCCTTCCGTTGGGGGGTATCCTTGGGTCGTGTTGAGCTGCCTTCTTTTCGTGGGGTGTCATTCATCC
TCTTTGAGGAAGGCGCTTTCGTGGGGGTGACAAACTCCTTTGGCTCGGTCCGCTCTTCGCTATCACGCTTCGCTTGCCGTCGGGGGAAATCAGTGGGTTG
CGCGGTGCTTACCGTCTTCTTCTTGATGGTCAACCTCTCAGGGCTGCCCTCGTTCGTAGTGGTCGATTTCGCGGTGGTTTTCTCCTTCTTGTCCTCAGCC
GCAAGCTTCGTGGCCTCTTCGAGTCGGGTAGCCCACATCGTGCGATTCCGCTCCACATTGGCGAGGCAGCCTTCTAATCCAGCCAACATGCCTCCGAGCG
CACGCCACAGCGGGAACGCGCACGAGTCGACAAACGCCAAGTTAACACGCGCAAATTCAGCCGATCCGGGCGAGCATCCATGAAAGCCGTCGCTGAAATC
CCCAGCTCAACCTCCTCTGCATGCTGCTCATTGAATTCTTCTAGCAGCCTCGTAGTCCAGCGGAAGTGCTGCTCACAGGACTGAGTCGGGCCCGAGAGGT
CTGCCGAGTGCACAACAGCACTCACTAGCAGTTCACGCAGGGCCTCGTCATCGTTCCGGCTCCCACGGACTTGAGCTTCGTGTACTTGGCTACAATGCTA
GCGTGGCGATGCATATCAGTGGCAAGAATCGCGCGGATAATGCGCTTGCGAACCGCACGACGGCTTCCAACAGTGTCACTCGAGCCATCCTCCAAGCCAG
CCAGCACATCATTGCCAGGTCGGCGCATGGTCTCGAAGCATGCAGCTGAGTGCATGTTTTCCAGCACGGAGTGATCGTTATAACGACGAGCGAGGCGCGA
GCTGCACCTCACGTGAAAGTCGTTGGTTCTGGCGTCGTGGCCCATGTCGTGACAGAAAGCTGCCACGAACACTGCAAGTCGCTCTCGAGGAGCAAGTATC
AGTTCGCCGCAACGTTTCTGTCGGCTCCGCTCTGTGGCCTGCGCCTTCGTGGTCGGACTCACTCCGAGCGCAGTGGAAGCGGGAATCAGTGACGAAGCCA
GCTTTTTGCTCTGCGCAGTGAGCATGAGGAACGTCGTGTGCAGCGTGGCGAAGGCATGGTACGTGTTGTGATACGGCACGTCAAGGTACTGGGCCTGTAC
GCTGTGCAGGAAGCGGCGTAGCGTGGCTTCCGGCAGTGCGAATCCATCCATGAGGTCGTGCAGCTCGAACATGTCCACTGCGAGGTCAATGAGCTGAGCC
GGCGAGAACTGCCACGGATCCAGGTCCCATT