Description :
From Genome Similarity Track
Location :
Scaffold_1259:4810- 9010
Sequence
4200 bases(100 bases per row)
CCAAATTGGTCTTTTGACGCAACGGGCTTGCTGAACATGTGTAATTCTTGGGATCACAATTCAGCTCCGATAATCCAAAGAGAACGCTGTCGATATGTCA
GAAACTTAATGAAAAAGGGATACCGCAGTAGTCGCAACGAACAAATAACCACAGACTGGAGGAATCGAAGAGCAGATTATTGGAAATCAGCTCGGACTAA
ACCGAAGCAAACGCATACTGGTACACCTTATGAACCGGAATTTGAAGGAATATTATCTCCTAACAGAGATCTTTATGAACTTCTTACACGCGCCGCCGTT
GATTCTGCTACTAGACGATCTAGCCTTGCTTCCTTGAAATCGACATTTTCAGCAGTGTTTCAGGACAGTGTTGATGACAATGATGATGTACAACTCCTGC
AATCGGTGGATTCTAGTACCGTTCCTTCGCAAAACCCCATATTTCACTTTACTGGGACTGATGCACGCGAGCATGGTGAAAACAGCTTATCTAGGATTGC
CACCTCTATCCAAATGCTTCAAAGTAATGCCAGCGATTCAAACGGACAACGACCACCTAAAGAAGGAGGAGTTGGTGGTGTTCACGATCCCTTCGAAGAT
GAGTGCTTCATCGAGCCGTGTGAATTATCTAACGAGCAACTCACTGTCGTTAAATCGGTTTTGAATGGTATCGATAAGGGTCAAACGGGACAAACACTCA
CCTTGGTtcatggtggtggaggcaCCGGAAAATCATACGTCGTCCAACGAATATGTAGTGAAGTCCACCGACGTCGATATGAAGTGGTATCAACATGCCC
TACAGGGGCAGGAGCATGTCGATTGATAAACGGAAGAACATTCCATTCTGCCTTGAAGTGCAGCAAGAAGGGAAACCGACTGTCAGCACAATCTGCAGCT
TTCTTAAGGCAACTTTTTGGCCCGAACGTTGCACTTGTGATTGTTGACGAGATCTCGATGTTCAAGGCAAAATACTTGGTTCTGCTCGATGAACGACTTC
GAGGGCTCTATGACACCAATAAACTGTTCGGCGGTAAATCCATTTTGCTGGTACGCTGCGCTATGCTTACAAGAATCAACTGATACATCAATGCTTATAT
ATCTTCTTTTTTTTGCATTTTCGGTAGACAGGTGGTTTTTTGGCAGCTCCAAGTCGTGAGAGGAACTTCTCTTTGCAAGTGTATGTACATGCAAACAAAC
GATCCTGTTCTACTGCGAGCTAGGTACTTGTTTTCTCTGTTCAGCGTTTTTACGTTGCAGAAACAACAAAGAGCAAGCGAGTGCCGTACTCAACAAGCTT
TACTTGAGCGGTTCCGAAGACTACCCAATATTTACCCAGAGCAGAACCGGTGGAACAAATCTAACGCGGCCTACCATCCGATTGACGAAAGCATGATTAA
CGCTCTAACTCGGCCACTGACACAACAAGACACAATTAATGATGAAAGCTGGATAAATGGATCTGTGGTGCTCGTTACTAGTAACGTTGACAGGGCTGTA
TTAAACACTTGCATGGCTACGGAATTAGCACGCCGCAGCCAAGTGCTGCTATATCGATGGCGAAAACCTCTCCTGGGTGAAGTTCCAGATTTTGTTCAAG
AACTACTGTACAACGAAGCGGAACATCCAGAGCTTTTTGGATATTTTACTACGGTGCACTGGCCCAGATTCTAGACTACACTAACGGAAATGTCACCATT
GGTGTTGCGAATGGAACGCGGTGCTGGTACCACTCATTGGGTTGggatggcgaagaagcagtctCTAACGCGATGAGCCTAACCGAAGAAGCTCTACGCT
GTGGAAAATCAATAGTTGACTTACCAGAAGCTCCCGAGTTTATACACGTGCGACTAGCAGATCGCGATAGAAATTTGTTGGATGACTCGCAATGGACTAT
CGACGTAAATCTTGAGACCGCATGGAGTTTTGATGCTGACGGGCAACCAAGTCACAAAAAGTATGTAGTTATCCCGGTGGGAATAGTGCAGTCAAACGGT
GATAACTATACGCTCAAGCTTGATGACTCCggaaaagaagaaaaaaccATACGGTACGAGCAGCACGCTGTTGACTTGGCGTTAGCATTAACAGTCTGGA
AAGCCCAAGGGAGTACATTTAATCGTGTTATTGCGCTGTTAGAAGGGTCTAAAAACGCTCCAAGCTGGCAGTTCGAACATATATACGTCGCTGTGTCTAG
CGTGCGGAACGCTGAATCTCTACGGTGTTTGCACACTACAATTTCCCCCGATTATGATCAAATTCTCAGGTTGAGACCGAACGTGTTTACAGTGAAGTGG
CTAATGGACTTGGACGAAAATGGCAGGTGGAAACCTCGAAACGCTCGCGACTCGTTTAAATAGTCGCATAACTTTGAATGTCTTAACTTTTACTTACTTC
AGCTAGGCATTTCTTGCACTTACACTCTTTAAAGTTGAATGAAGAACCATAATTAAAAGTAATCTCTTCGCCAGAAAGAATTGTTCTGCTAGCCACAAGT
CCAGTTCGATATTTGCCGCCGACGGACCACTCCTCTGCCATACAGTTTGGATCACAGCTATGATATATAAAACGCGATATATTTCCGACACGACTGGAAT
CGATGAACTTTCCGCAACCATAGGCCATCATGTACATGCTAGGACGCACACCATCCCTCCTCCTTTTTTCTTTTTCAGCAATGATCTCACCCACGTATTC
TTGAACGAGTGAATCCTTTGGTATCGTTTCCAACGTAAATGCGCCGAAGCCTTTTCCTTCCGTTACACGAATCTCCAGTTCGACTTGAGCTAAATGATAC
GTTGCCCGCGGGCGATTGAAGCACAGTCCGCTAGAATTGCATGTCAGCGACGAACATTCGATCCGGCGCAAATGATTTCGACAACTCTCTTCACAATTTT
CACGCAAATGCACTTCTCTTCAGACCATTCGCTAATCTCCAACTTGCCAATATTCTCACCAATTGATACATAATCATGATCATCGCCACCGCCACTCTCA
TCCACTTCCAATTCCTGGCTTGATCTTTCGTTATGCGTTCGCACACTAACCTCCACATACTCGTCCAAATTCGTTTGGATATACCGCTTCTGCATATGCC
AAACGTATGCTTACACAACCTCCTGGCCGTACGCTTCAGATTCTTTTATGAAATGATTTGACACTGGCGTGATTCAATCCTAGTCGATTCCCATCATCCG
TACTGTGCGGTCAGTCTCTTGTGAGAACGGTCGAAACATGTTGATGCAGAGTGAGTCCCGTGTGAAAACGGTCAAAACAAATACGTATCAACTTCGCTTT
GGTTTTAACGACTATATATCATTTTAAACCAAATGTAAACCATATTTCTTAACAGTTTCACAGAATGTAGTTTCACATACTAAATAACATTTAAAAGCCC
GAAATGCTTAAAAGAAAACAAggtgcatctgcagcagctatACGATGGCTTCATTTATATTGCTTTTTTATGTTTACTTTTTATCCATCTTAATTTTTTA
CCGCGGAAAAACTACATTGACAAGCTCAATTGCCCTAGATCAAACACATCATACAGCTGAGTGTTCGCTGTGCAGTTAATGTATAGCTGCACAAATGCGT
GCAGTAATTACAAACTTCCAATCTCATACTTCTACCTGCTTCAAGGGCAACTGAGGGAGTACATGTGCCGCCTTGTTAGGCCTGCCGGTGTGCATGAATG
TCCGACGTGCCTGTTGATTGTGACACGAGAACGCAAGGGTAATACACGCGCGGGAATTATCCCGACATTTGGTTTAAAATGAGATAGTTTTAACGACTAT
ATTCGCGTCCGTCAAAGCAGTTTTCGCGTCTAATTAGCGAACAGTCGAGAAGATCTGGGCAAGTCGACATGGACACAAGAGGGCGAGATCTGCCTGTATG
TAACGCTCTTGCTAATTGCTGTAGAACTACTTCACCAACTCCAAATAATCCTGGTAGCTCAACAGAAGCAGTTCTCAGCATGGCCTCCGCTCTAACTCTT
AATATAGTTGTCACTGACGAGGTCTTTGCGAAAACAATTTCATCACAGTTAGAAAGAACTCCATCCATTGCTCTCAGGTTTCCACTCAACCGTTGGCACC
AATGCTAACTTCCAACTGCCACACGTAAAACCCGGTCGTGACGCTGATAATGTATGTGCACATAACATGCTCAACTGGAGCACCAAATACACGTGATTCG